Transcript: Human NM_001258396.2

Homo sapiens coiled-coil domain containing 103 (CCDC103), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
CCDC103 (388389)
Length:
3426
CDS:
125..853

Additional Resources:

NCBI RefSeq record:
NM_001258396.2
NBCI Gene record:
CCDC103 (388389)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001258396.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000246280 CCTGGAACTGTCACACTATTC pLKO_005 339 CDS 100% 10.800 7.560 N CCDC103 n/a
2 TRCN0000246278 CTGCTGATGAGAAGTACAAAC pLKO_005 186 CDS 100% 10.800 7.560 N CCDC103 n/a
3 TRCN0000246279 TGCTGACTTCTATCGTGATTG pLKO_005 430 CDS 100% 10.800 7.560 N CCDC103 n/a
4 TRCN0000168319 GAGAAGTACAAACGGGAGAAT pLKO.1 194 CDS 100% 4.950 3.465 N CCDC103 n/a
5 TRCN0000172827 GTTTCAGAAGCTGCAAGCCAT pLKO.1 706 CDS 100% 2.640 1.848 N CCDC103 n/a
6 TRCN0000246276 GGTTCTGCAGGACCATAATAA pLKO_005 919 3UTR 100% 15.000 9.000 N CCDC103 n/a
7 TRCN0000246277 CAGGATGTGGCCACTGAAATC pLKO_005 374 CDS 100% 10.800 6.480 N CCDC103 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001258396.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05580 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_05580 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000479429 CGGATTGTTCATCTCTTCATCCAA pLX_317 32.1% 100% 100% V5 n/a
Download CSV