Transcript: Human XM_024453750.1

PREDICTED: Homo sapiens ventricular zone expressed PH domain containing 1 (VEPH1), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
VEPH1 (79674)
Length:
1280
CDS:
452..985

Additional Resources:

NCBI RefSeq record:
XM_024453750.1
NBCI Gene record:
VEPH1 (79674)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024453750.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000431457 TGACCAGGCAGTAGTTGAAAT pLKO_005 610 CDS 100% 13.200 18.480 N VEPH1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024453750.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15987 pDONR223 0% 82.9% 82.6% None 530T>G;531_532ins108 n/a
2 ccsbBroad304_15987 pLX_304 0% 82.9% 82.6% V5 530T>G;531_532ins108 n/a
3 TRCN0000471028 CCGGGAAATGGTCAAATTATAAAT pLX_317 67.5% 82.9% 82.6% V5 530T>G;531_532ins108 n/a
4 ccsbBroadEn_04106 pDONR223 100% 21.2% 21.1% None 530T>G;531_532ins1968 n/a
5 ccsbBroad304_04106 pLX_304 0% 21.2% 21.1% V5 530T>G;531_532ins1968 n/a
6 TRCN0000472697 CAATACCTGCAAAGTACAACAGAT pLX_317 16.6% 21.2% 21.1% V5 530T>G;531_532ins1968 n/a
Download CSV