Transcript: Human NM_002067.5

Homo sapiens G protein subunit alpha 11 (GNA11), mRNA.

Source:
NCBI, updated 2019-09-26
Taxon:
Homo sapiens (human)
Gene:
GNA11 (2767)
Length:
4190
CDS:
291..1370

Additional Resources:

NCBI RefSeq record:
NM_002067.5
NBCI Gene record:
GNA11 (2767)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_002067.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000036463 CGACAGCGACAAGATCATCTA pLKO.1 1244 CDS 100% 4.950 6.930 N GNA11 n/a
2 TRCN0000300433 CGACAGCGACAAGATCATCTA pLKO_005 1244 CDS 100% 4.950 6.930 N GNA11 n/a
3 TRCN0000036459 CGACCTGGAGAACATCATCTT pLKO.1 872 CDS 100% 4.950 3.465 N GNA11 n/a
4 TRCN0000300434 CGACCTGGAGAACATCATCTT pLKO_005 872 CDS 100% 4.950 3.465 N GNA11 n/a
5 TRCN0000036462 GAACGTGACATCCATCATGTT pLKO.1 953 CDS 100% 4.950 3.465 N GNA11 n/a
6 TRCN0000036461 GCTCAACCTCAAGGAGTACAA pLKO.1 1340 CDS 100% 4.950 3.465 N GNA11 n/a
7 TRCN0000300432 GCTCAACCTCAAGGAGTACAA pLKO_005 1340 CDS 100% 4.950 3.465 N GNA11 n/a
8 TRCN0000036460 GCTCAAGATCCTCTACAAGTA pLKO.1 578 CDS 100% 4.950 3.465 N GNA11 n/a
9 TRCN0000300431 GCTCAAGATCCTCTACAAGTA pLKO_005 578 CDS 100% 4.950 3.465 N GNA11 n/a
10 TRCN0000437691 AGAACATCCGCTTCGTGTTTC pLKO_005 1294 CDS 100% 10.800 6.480 N Gna12 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_002067.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00650 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00650 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000481250 AGCAATGTCGGCCTCTATCAGTAG pLX_317 35.8% 100% 100% V5 n/a
Download CSV