Transcript: Human NM_001368062.1

Homo sapiens otogelin like (OTOGL), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
OTOGL (283310)
Length:
10859
CDS:
1128..8027

Additional Resources:

NCBI RefSeq record:
NM_001368062.1
NBCI Gene record:
OTOGL (283310)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001368062.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000147298 GCAGGGAAATATAGCATCATT pLKO.1 8830 3UTR 100% 5.625 7.875 N OTOGL n/a
2 TRCN0000148411 CCTGTTCCACTATGTCATGAT pLKO.1 7005 CDS 100% 4.950 3.465 N OTOGL n/a
3 TRCN0000183245 GCCCTATAAATGTTGCATCTT pLKO.1 7822 CDS 100% 4.950 3.465 N OTOGL n/a
4 TRCN0000149380 GCTGTGTGACTCGTACAAATT pLKO.1 8586 3UTR 100% 13.200 7.920 N OTOGL n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001368062.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13497 pDONR223 100% 9.7% 9.7% None 1_6225del;6294G>A n/a
2 ccsbBroad304_13497 pLX_304 0% 9.7% 9.7% V5 1_6225del;6294G>A n/a
Download CSV