Transcript: Human NM_153343.4

Homo sapiens ectonucleotide pyrophosphatase/phosphodiesterase 6 (ENPP6), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
ENPP6 (133121)
Length:
3848
CDS:
55..1377

Additional Resources:

NCBI RefSeq record:
NM_153343.4
NBCI Gene record:
ENPP6 (133121)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_153343.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000355956 ATCACGGAATGACCGACATTT pLKO_005 773 CDS 100% 13.200 18.480 N ENPP6 n/a
2 TRCN0000356006 TGCTTGCATAACTGATCATAT pLKO_005 1367 CDS 100% 13.200 18.480 N ENPP6 n/a
3 TRCN0000006952 CCCACCTACTGCCTAGAATAT pLKO.1 505 CDS 100% 13.200 9.240 N ENPP6 n/a
4 TRCN0000367678 GGACCGCCTGAACGTCATTAT pLKO_005 744 CDS 100% 13.200 9.240 N ENPP6 n/a
5 TRCN0000006949 CCCTGCATATTGATGGACAAA pLKO.1 2164 3UTR 100% 4.950 3.465 N ENPP6 n/a
6 TRCN0000006950 CGCTCAGACTACATCAGTGAT pLKO.1 157 CDS 100% 4.950 3.465 N ENPP6 n/a
7 TRCN0000011058 CCTTTGACTTTAGTGGCTGAT pLKO.1 1006 CDS 100% 4.050 2.835 N ENPP6 n/a
8 TRCN0000006951 GCGTCAACAAAGACAGCCTAA pLKO.1 371 CDS 100% 4.050 2.835 N ENPP6 n/a
9 TRCN0000081042 GATTACTTGACTCCAGACTTT pLKO.1 235 CDS 100% 4.950 3.465 N Enpp6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_153343.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04882 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04882 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000475058 CGATATTCTATAAACCACCCGGAG pLX_317 27.6% 100% 100% V5 n/a
Download CSV