Transcript: Human NM_182977.3

Homo sapiens nicotinamide nucleotide transhydrogenase (NNT), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
NNT (23530)
Length:
6421
CDS:
169..3429

Additional Resources:

NCBI RefSeq record:
NM_182977.3
NBCI Gene record:
NNT (23530)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_182977.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000221880 CGAGAAGCTAATAGCATTATT pLKO.1 2932 CDS 100% 15.000 21.000 N NNT n/a
2 TRCN0000278376 CGAGAAGCTAATAGCATTATT pLKO_005 2932 CDS 100% 15.000 21.000 N NNT n/a
3 TRCN0000221876 GCACCTTTGTTGGTGGATATT pLKO.1 1976 CDS 100% 13.200 18.480 N NNT n/a
4 TRCN0000297432 GCACCTTTGTTGGTGGATATT pLKO_005 1976 CDS 100% 13.200 18.480 N NNT n/a
5 TRCN0000221879 CGTGTCCTCTACTTAGCAATT pLKO.1 206 CDS 100% 10.800 15.120 N NNT n/a
6 TRCN0000278311 CGTGTCCTCTACTTAGCAATT pLKO_005 206 CDS 100% 10.800 15.120 N NNT n/a
7 TRCN0000221878 CGTCGTTATCACTGTGCTGAA pLKO.1 2664 CDS 100% 4.050 5.670 N NNT n/a
8 TRCN0000278312 CGTCGTTATCACTGTGCTGAA pLKO_005 2664 CDS 100% 4.050 5.670 N NNT n/a
9 TRCN0000221877 CCCTATGGTTAATCCAACATT pLKO.1 558 CDS 100% 5.625 4.500 N NNT n/a
10 TRCN0000278313 CCCTATGGTTAATCCAACATT pLKO_005 558 CDS 100% 5.625 4.500 N NNT n/a
11 TRCN0000156019 CATGGAATACTATGCAGCCAT pLKO.1 5796 3UTR 100% 2.640 1.320 Y LOC340211 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_182977.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15765 pDONR223 0% 19% 19% None 1_2637del;2898A>G n/a
2 ccsbBroad304_15765 pLX_304 0% 19% 19% V5 1_2637del;2898A>G n/a
Download CSV