Transcript: Human NM_001126063.3

Homo sapiens KH domain containing 1 like (KHDC1L), mRNA.

Source:
NCBI, updated 2019-08-03
Taxon:
Homo sapiens (human)
Gene:
KHDC1L (100129128)
Length:
679
CDS:
89..475

Additional Resources:

NCBI RefSeq record:
NM_001126063.3
NBCI Gene record:
KHDC1L (100129128)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001126063.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000270223 TCGAGGTCTGAAGATGCTAGA pLKO_005 379 CDS 100% 4.050 3.240 N KHDC1L n/a
2 TRCN0000284149 GCTGCTGCTCATGTTCCATTG pLKO_005 328 CDS 100% 6.000 4.200 N KHDC1L n/a
3 TRCN0000269917 GGAGCTCATCTTCGGACTTGA pLKO_005 187 CDS 100% 4.950 3.465 N KHDC1L n/a
4 TRCN0000269916 AGTCGGACCACCAATGGCAAA pLKO_005 301 CDS 100% 4.050 2.835 N KHDC1L n/a
5 TRCN0000162248 CTTTCATTCTCCAATGGTGTT pLKO.1 145 CDS 100% 4.050 2.835 N KHDC1 n/a
6 TRCN0000269918 TTCATTCTCCAATGGTGTTCC pLKO_005 147 CDS 100% 4.050 2.835 N KHDC1L n/a
7 TRCN0000164717 CTTCGGACTTGATGACACGTA pLKO.1 196 CDS 100% 2.640 1.848 N KHDC1 n/a
8 TRCN0000166784 CCAATGGTGTTCCACATGGAA pLKO.1 155 CDS 100% 3.000 1.800 N KHDC1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001126063.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12704 pDONR223 100% 68.9% 65.2% None (many diffs) n/a
2 ccsbBroad304_12704 pLX_304 0% 68.9% 65.2% V5 (many diffs) n/a
3 TRCN0000470308 CGTTCACCAGGGATGGCGTAGCAC pLX_317 93.9% 68.9% 65.2% V5 (many diffs) n/a
Download CSV