Transcript: Human NM_001078166.2

Homo sapiens serine and arginine rich splicing factor 1 (SRSF1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-07-07
Taxon:
Homo sapiens (human)
Gene:
SRSF1 (6426)
Length:
5543
CDS:
110..715

Additional Resources:

NCBI RefSeq record:
NM_001078166.2
NBCI Gene record:
SRSF1 (6426)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001078166.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000001094 ACTGCCTACATCCGGGTTAAA pLKO.1 868 3UTR 100% 13.200 18.480 N SRSF1 n/a
2 TRCN0000001093 GCAACCACGAAACCTGTAATA pLKO.1 2184 3UTR 100% 13.200 18.480 N SRSF1 n/a
3 TRCN0000272898 GCAACCACGAAACCTGTAATA pLKO_005 2184 3UTR 100% 13.200 18.480 N SRSF1 n/a
4 TRCN0000272897 TGGTCGCGACGGCTATGATTA pLKO_005 325 CDS 100% 13.200 18.480 N SRSF1 n/a
5 TRCN0000010592 CAAGTTATGGAAGATCTCGAT pLKO.1 908 3UTR 100% 2.640 2.112 N SRSF1 n/a
6 TRCN0000272900 AGATCTCGCTCTCGTACATAA pLKO_005 1036 3UTR 100% 13.200 9.240 N SRSF1 n/a
7 TRCN0000294703 TATCTGAAGAGATGGATTAAG pLKO_005 1424 3UTR 100% 13.200 9.240 N Srsf1 n/a
8 TRCN0000001096 ACTTACCTCCAGACATCCGAA pLKO.1 174 CDS 100% 2.640 1.848 N SRSF1 n/a
9 TRCN0000272896 ACTTACCTCCAGACATCCGAA pLKO_005 174 CDS 100% 2.640 1.848 N SRSF1 n/a
10 TRCN0000001095 GAAGCAGGTGATGTATGTTAT pLKO.1 536 CDS 100% 13.200 7.920 N SRSF1 n/a
11 TRCN0000272899 GAAGCAGGTGATGTATGTTAT pLKO_005 536 CDS 100% 13.200 7.920 N SRSF1 n/a
12 TRCN0000109143 GCAGAGGATCACCACGCTATT pLKO.1 1001 3UTR 100% 10.800 6.480 N Srsf1 n/a
13 TRCN0000287198 GCAGAGGATCACCACGCTATT pLKO_005 1001 3UTR 100% 10.800 6.480 N Srsf1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001078166.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01521 pDONR223 100% 76% 75% None (many diffs) n/a
2 ccsbBroad304_01521 pLX_304 0% 76% 75% V5 (many diffs) n/a
Download CSV