Transcript: Human NM_022052.2

Homo sapiens nuclear RNA export factor 3 (NXF3), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
NXF3 (56000)
Length:
1956
CDS:
121..1716

Additional Resources:

NCBI RefSeq record:
NM_022052.2
NBCI Gene record:
NXF3 (56000)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_022052.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000060325 CCTATACTATTTCACCCTATA pLKO.1 323 CDS 100% 10.800 15.120 N NXF3 n/a
2 TRCN0000060324 CCAGAGCAACTTTATGTGGTA pLKO.1 1064 CDS 100% 2.640 3.696 N NXF3 n/a
3 TRCN0000060327 ACAAGCTCTTTGTGCGGGATA pLKO.1 1589 CDS 100% 4.050 2.835 N NXF3 n/a
4 TRCN0000060323 CCAGTAAGATACACTCCCTAT pLKO.1 307 CDS 100% 4.050 2.835 N NXF3 n/a
5 TRCN0000060326 CTGCTGAATTTGATTCAGAAT pLKO.1 505 CDS 100% 0.495 0.347 N NXF3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_022052.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03694 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03694 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000479445 ATATCGTTATAACGGATAACGGGT pLX_317 18.8% 100% 100% V5 n/a
Download CSV