Transcript: Human NM_147187.3

Homo sapiens TNF receptor superfamily member 10b (TNFRSF10B), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-15
Taxon:
Homo sapiens (human)
Gene:
TNFRSF10B (8795)
Length:
3911
CDS:
138..1373

Additional Resources:

NCBI RefSeq record:
NM_147187.3
NBCI Gene record:
TNFRSF10B (8795)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_147187.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000005932 CTCACTGGAATGACCTCCTTT pLKO.1 451 CDS 100% 4.950 3.465 N TNFRSF10B n/a
2 TRCN0000279756 CTCACTGGAATGACCTCCTTT pLKO_005 451 CDS 100% 4.950 3.465 N TNFRSF10B n/a
3 TRCN0000005933 GCAGAAGATTGAGGACCACTT pLKO.1 1295 CDS 100% 4.050 2.835 N TNFRSF10B n/a
4 TRCN0000279755 GCAGAAGATTGAGGACCACTT pLKO_005 1295 CDS 100% 4.050 2.835 N TNFRSF10B n/a
5 TRCN0000005929 GCAGTCTCATTTGCACCCATA pLKO.1 2421 3UTR 100% 4.050 2.835 N TNFRSF10B n/a
6 TRCN0000279825 GCAGTCTCATTTGCACCCATA pLKO_005 2421 3UTR 100% 4.050 2.835 N TNFRSF10B n/a
7 TRCN0000005931 GCTGAGGACAATGTCCTCAAT pLKO.1 849 CDS 100% 0.495 0.347 N TNFRSF10B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_147187.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07304 pDONR223 100% 93.3% 93.1% None 95C>T;546_547ins87 n/a
2 ccsbBroad304_07304 pLX_304 0% 93.3% 93.1% V5 95C>T;546_547ins87 n/a
Download CSV