Transcript: Human NM_001307922.2

Homo sapiens RWD domain containing 4 (RWDD4), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
RWDD4 (201965)
Length:
2597
CDS:
419..796

Additional Resources:

NCBI RefSeq record:
NM_001307922.2
NBCI Gene record:
RWDD4 (201965)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001307922.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000364499 AGAAGCATTACGCTCTATTTA pLKO_005 266 5UTR 100% 15.000 21.000 N RWDD4 n/a
2 TRCN0000364494 ATGAAAGTTTCCGGGAATTAA pLKO_005 295 5UTR 100% 15.000 21.000 N RWDD4 n/a
3 TRCN0000364493 CCATAGTGCAATCCATATTAA pLKO_005 1192 3UTR 100% 15.000 21.000 N RWDD4 n/a
4 TRCN0000369097 GTGATCCCAAAGCCTTCTTAA pLKO_005 348 5UTR 100% 13.200 18.480 N RWDD4 n/a
5 TRCN0000369042 GCTTAATTACTGAACCGTAAA pLKO_005 1248 3UTR 100% 10.800 15.120 N RWDD4 n/a
6 TRCN0000369044 TCAATTCCGCAACATCGATAA pLKO_005 582 CDS 100% 10.800 15.120 N RWDD4 n/a
7 TRCN0000011189 GCTATGACCTATACATTGTTT pLKO.1 512 CDS 100% 5.625 7.875 N RWDD4 n/a
8 TRCN0000011187 CGCCCAGCTTTAAGAACACAT pLKO.1 1898 3UTR 100% 4.950 6.930 N RWDD4 n/a
9 TRCN0000011188 CGCTCTATTTATGAAGGAGAT pLKO.1 276 5UTR 100% 4.050 3.240 N RWDD4 n/a
10 TRCN0000011191 GTTGTGAAGCATTTAAGCAAA pLKO.1 752 CDS 100% 4.950 3.465 N RWDD4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001307922.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05202 pDONR223 100% 66.4% 66.4% None 0_1ins189 n/a
2 ccsbBroad304_05202 pLX_304 0% 66.4% 66.4% V5 0_1ins189 n/a
3 TRCN0000465433 TACAGATGCCATTAACTCAATACA pLX_317 51.1% 66.4% 66.4% V5 0_1ins189 n/a
Download CSV