Transcript: Human NM_006153.6

Homo sapiens NCK adaptor protein 1 (NCK1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
NCK1 (4690)
Length:
4417
CDS:
131..1264

Additional Resources:

NCBI RefSeq record:
NM_006153.6
NBCI Gene record:
NCK1 (4690)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_006153.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000122931 GCAGTCGTCAATAACCTAAAT pLKO.1 671 CDS 100% 13.200 18.480 N NCK1 n/a
2 TRCN0000428843 ACCTCAACATGCCCGCTTATG pLKO_005 447 CDS 100% 10.800 15.120 N NCK1 n/a
3 TRCN0000122933 GCGAGTTCGAAATTCCATGAA pLKO.1 247 CDS 100% 4.950 6.930 N NCK1 n/a
4 TRCN0000122932 GCAGCAGTCGTCAATAACCTA pLKO.1 668 CDS 100% 3.000 4.200 N NCK1 n/a
5 TRCN0000337636 CCTGGTGGCGAGTTCGAAATT pLKO_005 240 CDS 100% 13.200 10.560 N Nck1 n/a
6 TRCN0000337705 CTGGCAATCCTTGGTATTATG pLKO_005 963 CDS 100% 13.200 9.240 N Nck1 n/a
7 TRCN0000362658 TGATTTCTCAGTATCACTAAA pLKO_005 1075 CDS 100% 13.200 9.240 N Nck1 n/a
8 TRCN0000430376 GATAGTGAATCTTCGCCAAAT pLKO_005 1055 CDS 100% 10.800 7.560 N NCK1 n/a
9 TRCN0000023696 CCTTCAAACTATGTAACTGAA pLKO.1 596 CDS 100% 4.950 3.465 N Nck1 n/a
10 TRCN0000122930 GCAGCGTAAATTCAGCACCAT pLKO.1 1156 CDS 100% 2.640 1.848 N NCK1 n/a
11 TRCN0000122929 GCCATTGTAAATACCAAGTAT pLKO.1 1778 3UTR 100% 5.625 3.375 N NCK1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_006153.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01062 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01062 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000473644 TTCCAACATACCTGCAGATCGAAA pLX_317 6.5% 100% 100% V5 n/a
Download CSV