Transcript: Human XM_011534394.3

PREDICTED: Homo sapiens transmembrane protein 165 (TMEM165), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TMEM165 (55858)
Length:
2293
CDS:
237..1202

Additional Resources:

NCBI RefSeq record:
XM_011534394.3
NBCI Gene record:
TMEM165 (55858)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011534394.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000157390 GCTTCGGGAAGGCTTAAAGAT pLKO.1 758 CDS 100% 5.625 3.938 N TMEM165 n/a
2 TRCN0000153034 GAGATGTTGAAACGGGTACAA pLKO.1 877 CDS 100% 4.950 3.465 N TMEM165 n/a
3 TRCN0000153606 CTTGGGACTAATGACATGCTT pLKO.1 644 CDS 100% 3.000 2.100 N TMEM165 n/a
4 TRCN0000158098 CCTTGGGACTAATGACATGCT pLKO.1 643 CDS 100% 2.640 1.848 N TMEM165 n/a
5 TRCN0000152975 GATTGGCAGTAATTGGAGGAA pLKO.1 1081 CDS 100% 2.640 1.848 N TMEM165 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011534394.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12284 pDONR223 100% 58% 55.7% None (many diffs) n/a
2 ccsbBroad304_12284 pLX_304 0% 58% 55.7% V5 (many diffs) n/a
3 TRCN0000474428 GGGCGCGAGGCGGTCAGCTCTGCT pLX_317 90.2% 58% 55.7% V5 (many diffs) n/a
Download CSV