Transcript: Human NM_182553.3

Homo sapiens cornichon family AMPA receptor auxiliary protein 2 (CNIH2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
CNIH2 (254263)
Length:
1374
CDS:
283..765

Additional Resources:

NCBI RefSeq record:
NM_182553.3
NBCI Gene record:
CNIH2 (254263)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_182553.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000109844 GTACAGTATGGTTTATACGTT pLKO.1 732 CDS 100% 3.000 4.200 N Cnih2 n/a
2 TRCN0000157247 CATGTATGATGCGGTCTCCAT pLKO.1 627 CDS 100% 2.640 3.696 N CNIH2 n/a
3 TRCN0000157853 CAGAGCTTGACCCTGGAAATT pLKO.1 1088 3UTR 100% 13.200 9.240 N CNIH2 n/a
4 TRCN0000158206 CACCTTGTCTCTTGGACCTAT pLKO.1 1277 3UTR 100% 4.950 3.465 N CNIH2 n/a
5 TRCN0000153213 CTCCCTCATCTTCTTTGTCAT pLKO.1 336 CDS 100% 4.950 3.465 N CNIH2 n/a
6 TRCN0000157380 CTGGTGCAAACTTGCCTTCTA pLKO.1 687 CDS 100% 4.950 3.465 N CNIH2 n/a
7 TRCN0000154246 CTTTGTCATCTGGCACATCAT pLKO.1 348 CDS 100% 4.950 3.465 N CNIH2 n/a
8 TRCN0000153852 CTTCTTTGTCATCTGGCACAT pLKO.1 345 CDS 100% 4.050 2.835 N CNIH2 n/a
9 TRCN0000153410 GCTCTCCTTCTTCTATTACCT pLKO.1 711 CDS 100% 3.000 2.100 N CNIH2 n/a
10 TRCN0000158144 CTGATGTTTCTGTGTGCAGCA pLKO.1 520 CDS 100% 2.160 1.512 N CNIH2 n/a
11 TRCN0000153620 CATTCTCAACTACTGCCAGAA pLKO.1 660 CDS 100% 4.050 2.430 N CNIH2 n/a
12 TRCN0000109841 TCATGTATGATGCGGTCTCTA pLKO.1 626 CDS 100% 4.950 6.930 N Cnih2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_182553.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05299 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_05299 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000467503 CGCAGATAACCCTCGATAACGGCT pLX_317 71.6% 100% 100% V5 n/a
Download CSV