Transcript: Human NM_001363647.1

Homo sapiens crystallin lambda 1 (CRYL1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
CRYL1 (51084)
Length:
1339
CDS:
80..877

Additional Resources:

NCBI RefSeq record:
NM_001363647.1
NBCI Gene record:
CRYL1 (51084)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001363647.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000422569 GCATGCGGTATGCATTCATTG pLKO_005 603 CDS 100% 10.800 15.120 N CRYL1 n/a
2 TRCN0000444155 GCCCGTCACTTTGGATCATAG pLKO_005 1037 3UTR 100% 10.800 15.120 N CRYL1 n/a
3 TRCN0000419316 GGAACACTGCAAGCCCTTAAT pLKO_005 925 3UTR 100% 13.200 9.240 N CRYL1 n/a
4 TRCN0000064940 CCAGGTGAAACTCTATGACAT pLKO.1 169 CDS 100% 4.950 3.465 N CRYL1 n/a
5 TRCN0000064939 GCATCTCAATGCAGAAGGTAT pLKO.1 640 CDS 100% 4.950 3.465 N CRYL1 n/a
6 TRCN0000064942 GCCTGCAATATGCAATCATCA pLKO.1 507 CDS 100% 4.950 3.465 N CRYL1 n/a
7 TRCN0000064941 CCCAATATCCAAGAAGCAGTA pLKO.1 314 CDS 100% 4.050 2.835 N CRYL1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001363647.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11944 pDONR223 100% 76.1% 76.1% None 1_66del;276_277ins162 n/a
2 ccsbBroad304_11944 pLX_304 0% 76.1% 76.1% V5 1_66del;276_277ins162 n/a
3 TRCN0000491902 TCAATGCCATAAGGCCAACAGTCC pLX_317 42.8% 76.1% 76.1% V5 1_66del;276_277ins162 n/a
Download CSV