Transcript: Human NM_030811.4

Homo sapiens mitochondrial ribosomal protein S26 (MRPS26), mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
MRPS26 (64949)
Length:
1016
CDS:
18..635

Additional Resources:

NCBI RefSeq record:
NM_030811.4
NBCI Gene record:
MRPS26 (64949)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_030811.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000276224 ATCCAAGATCGAGCGAGTGAA pLKO_005 125 CDS 100% 4.950 6.930 N MRPS26 n/a
2 TRCN0000184106 CAAGATCGAGCGAGTGAACAT pLKO.1 128 CDS 100% 4.950 6.930 N MRPS26 n/a
3 TRCN0000146373 CAGGGACCATGTATGTATCAT pLKO.1 660 3UTR 100% 5.625 3.938 N MRPS26 n/a
4 TRCN0000276270 CAGGGACCATGTATGTATCAT pLKO_005 660 3UTR 100% 5.625 3.938 N MRPS26 n/a
5 TRCN0000179426 CTGACCTGGAATAAAGCAGTT pLKO.1 697 3UTR 100% 4.050 2.835 N MRPS26 n/a
6 TRCN0000122367 CTTCGTGCTGATGGAGCGTTA pLKO.1 176 CDS 100% 4.050 2.835 N MRPS26 n/a
7 TRCN0000282045 CTTCGTGCTGATGGAGCGTTA pLKO_005 176 CDS 100% 4.050 2.835 N MRPS26 n/a
8 TRCN0000122674 GAAGAACTACAACTGGGCCAT pLKO.1 569 CDS 100% 2.160 1.512 N MRPS26 n/a
9 TRCN0000195986 CCATGTATGTATCATGGCGGA pLKO.1 666 3UTR 100% 0.054 0.038 N MRPS26 n/a
10 TRCN0000282044 CAGCTGCAGGAAGAGGTGAAA pLKO_005 492 CDS 100% 4.950 2.970 N MRPS26 n/a
11 TRCN0000184638 CTGTCACCACTTGGTCAGAAA pLKO.1 778 3UTR 100% 4.950 2.970 N MRPS26 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_030811.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03988 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03988 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000492038 ACCCTCCAAAGATGTTCAACTGCA pLX_317 65.8% 100% 100% V5 n/a
Download CSV