Transcript: Human NM_145049.5

Homo sapiens ubiquitin like domain containing CTD phosphatase 1 (UBLCP1), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
UBLCP1 (134510)
Length:
2179
CDS:
118..1074

Additional Resources:

NCBI RefSeq record:
NM_145049.5
NBCI Gene record:
UBLCP1 (134510)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_145049.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000073181 CGGCCATATCTTCATGAATTT pLKO.1 604 CDS 100% 13.200 18.480 N UBLCP1 n/a
2 TRCN0000073179 GCGCACCTAAATCGTGATAAA pLKO.1 937 CDS 100% 13.200 18.480 N UBLCP1 n/a
3 TRCN0000417586 ACCTAGTTTGCTATGCTTAAA pLKO_005 1573 3UTR 100% 13.200 10.560 N UBLCP1 n/a
4 TRCN0000434771 CAAGTTATACTGGCAGTTATT pLKO_005 1078 3UTR 100% 13.200 9.240 N UBLCP1 n/a
5 TRCN0000073182 GCTCTCAAACTGAAACCAAAT pLKO.1 304 CDS 100% 10.800 7.560 N UBLCP1 n/a
6 TRCN0000073180 CGCAGAGTGAAAGAGTACAAA pLKO.1 475 CDS 100% 5.625 3.938 N UBLCP1 n/a
7 TRCN0000073178 GCTGTGTCTTAGTATGAGAAA pLKO.1 1741 3UTR 100% 4.950 3.465 N UBLCP1 n/a
8 TRCN0000414471 TAAAGCCTCTTGGTGTTATAT pLKO_005 803 CDS 100% 15.000 9.000 N UBLCP1 n/a
9 TRCN0000420919 CATCTGCCTATGAAGATTATG pLKO_005 629 CDS 100% 13.200 7.920 N UBLCP1 n/a
10 TRCN0000166364 CACACACACACACACACACAA pLKO.1 1368 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_145049.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14382 pDONR223 100% 99.7% 98.7% None 944_945delAG n/a
2 ccsbBroad304_14382 pLX_304 0% 99.7% 98.7% V5 (not translated due to frame shift) 944_945delAG n/a
3 TRCN0000468612 TTAACGTATTATTTTTGTATAGAA pLX_317 34.8% 99.7% 98.7% V5 (not translated due to prior stop codon) 944_945delAG n/a
Download CSV