Transcript: Human XM_011532764.3

PREDICTED: Homo sapiens gamma-glutamyl carboxylase (GGCX), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GGCX (2677)
Length:
3059
CDS:
724..2178

Additional Resources:

NCBI RefSeq record:
XM_011532764.3
NBCI Gene record:
GGCX (2677)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011532764.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000078520 CCGGATAAGCTGTGTGTTATT pLKO.1 470 5UTR 100% 13.200 18.480 N GGCX n/a
2 TRCN0000315778 CCGGATAAGCTGTGTGTTATT pLKO_005 470 5UTR 100% 13.200 18.480 N GGCX n/a
3 TRCN0000078519 CCTTTCTTAGACGCCAACAAA pLKO.1 1874 CDS 100% 5.625 7.875 N GGCX n/a
4 TRCN0000315777 CCTTTCTTAGACGCCAACAAA pLKO_005 1874 CDS 100% 5.625 7.875 N GGCX n/a
5 TRCN0000078522 CCAGTGTTTCCTGTGTGTATA pLKO.1 917 CDS 100% 13.200 9.240 N GGCX n/a
6 TRCN0000315779 CCAGTGTTTCCTGTGTGTATA pLKO_005 917 CDS 100% 13.200 9.240 N GGCX n/a
7 TRCN0000078518 GCTAACATTCATGGATGCAAA pLKO.1 575 5UTR 100% 4.950 3.465 N GGCX n/a
8 TRCN0000315780 GCTAACATTCATGGATGCAAA pLKO_005 575 5UTR 100% 4.950 3.465 N GGCX n/a
9 TRCN0000078521 CGGCGAAATACTCCTTTCCAT pLKO.1 1915 CDS 100% 3.000 2.100 N GGCX n/a
10 TRCN0000315855 CGGCGAAATACTCCTTTCCAT pLKO_005 1915 CDS 100% 3.000 2.100 N GGCX n/a
11 TRCN0000119650 CCTGGCATATCTGCAAGAATT pLKO.1 1743 CDS 100% 0.000 0.000 N Ggcx n/a
12 TRCN0000323663 CCTGGCATATCTGCAAGAATT pLKO_005 1743 CDS 100% 0.000 0.000 N Ggcx n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011532764.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00632 pDONR223 100% 63.8% 60.1% None 0_1ins658;67_68ins164 n/a
2 ccsbBroad304_00632 pLX_304 0% 63.8% 60.1% V5 0_1ins658;67_68ins164 n/a
Download CSV