Transcript: Human XM_024446144.1

PREDICTED: Homo sapiens centromere protein K (CENPK), transcript variant X16, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CENPK (64105)
Length:
1997
CDS:
239..910

Additional Resources:

NCBI RefSeq record:
XM_024446144.1
NBCI Gene record:
CENPK (64105)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024446144.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000167369 GAAGACGTTCTCATAACATTA pLKO.1 494 CDS 100% 13.200 10.560 N CENPK n/a
2 TRCN0000414848 GAAACACTCACCGATTCAAAT pLKO_005 380 CDS 100% 13.200 9.240 N CENPK n/a
3 TRCN0000438194 TGAGTACCTTGGGCGAGTTTC pLKO_005 768 CDS 100% 10.800 7.560 N CENPK n/a
4 TRCN0000167368 GAAATGTGGAAAGATATGGAA pLKO.1 326 CDS 100% 3.000 2.100 N CENPK n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024446144.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03924 pDONR223 100% 81.4% 80.4% None (many diffs) n/a
2 ccsbBroad304_03924 pLX_304 0% 81.4% 80.4% V5 (many diffs) n/a
3 TRCN0000467235 TTGATGGAGCACTCTTGGTGCAAC pLX_317 29.7% 81.4% 80.4% V5 (many diffs) n/a
Download CSV