Transcript: Human NM_001142352.2

Homo sapiens ST6 beta-galactoside alpha-2,6-sialyltransferase 2 (ST6GAL2), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
ST6GAL2 (84620)
Length:
1658
CDS:
192..1592

Additional Resources:

NCBI RefSeq record:
NM_001142352.2
NBCI Gene record:
ST6GAL2 (84620)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001142352.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000035110 CGCATCATTAATTCGCAGATT pLKO.1 1215 CDS 100% 4.950 6.930 N ST6GAL2 n/a
2 TRCN0000035111 GCATCGTCAGAGAAACCCAAA pLKO.1 1379 CDS 100% 4.050 5.670 N ST6GAL2 n/a
3 TRCN0000035109 CGCAAATCTTAACCTGTGGTA pLKO.1 1319 CDS 100% 2.640 3.696 N ST6GAL2 n/a
4 TRCN0000035112 CAGTCCCAAGATGGGTTTGAA pLKO.1 492 CDS 100% 5.625 3.938 N ST6GAL2 n/a
5 TRCN0000035113 CGTGGTTATGAGAAAGATGTT pLKO.1 1176 CDS 100% 4.950 3.465 N ST6GAL2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001142352.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12833 pDONR223 100% 97.6% 97.6% None 1_33del n/a
2 ccsbBroad304_12833 pLX_304 0% 97.6% 97.6% V5 1_33del n/a
3 TRCN0000475492 TTAGCCAACGAATTTCATCAAGCA pLX_317 26.8% 97.6% 97.6% V5 1_33del n/a
Download CSV