Construct: ORF TRCN0000475492
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF002458.1_s317c1
- Derived from:
- ccsbBroadEn_12833
- DNA Barcode:
- TTAGCCAACGAATTTCATCAAGCA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- ST6GAL2 (84620)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000475492
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 84620 | ST6GAL2 | ST6 beta-galactoside alpha-... | NM_001142352.2 | 97.6% | 97.6% | 1_33del |
2 | human | 84620 | ST6GAL2 | ST6 beta-galactoside alpha-... | XM_011512001.2 | 97.6% | 97.6% | 1_33del |
3 | human | 84620 | ST6GAL2 | ST6 beta-galactoside alpha-... | XM_011512000.2 | 92.7% | 90.9% | (many diffs) |
4 | human | 84620 | ST6GAL2 | ST6 beta-galactoside alpha-... | XM_017005110.1 | 92.3% | 88.1% | (many diffs) |
5 | human | 84620 | ST6GAL2 | ST6 beta-galactoside alpha-... | NM_001142351.2 | 84% | 81.5% | (many diffs) |
6 | human | 84620 | ST6GAL2 | ST6 beta-galactoside alpha-... | NM_001322362.2 | 84% | 81.5% | (many diffs) |
7 | human | 84620 | ST6GAL2 | ST6 beta-galactoside alpha-... | NM_032528.3 | 84% | 81.5% | (many diffs) |
8 | human | 84620 | ST6GAL2 | ST6 beta-galactoside alpha-... | XM_006712802.1 | 84% | 81.5% | (many diffs) |
9 | human | 84620 | ST6GAL2 | ST6 beta-galactoside alpha-... | XM_011511999.2 | 84% | 81.5% | (many diffs) |
10 | human | 84620 | ST6GAL2 | ST6 beta-galactoside alpha-... | XR_923046.2 | 70.3% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1431
- ORF length:
- 1365
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgct tttcggaata ttcgcttggg ggctcctctt tttgctgatt ttcatctact 121 tcaccgacag caaccccgct gagcctgtac ccagctccct ctccttcctg gagaccagga 181 ggctcctgcc ggtgcagggg aagcagcggg ccatcatggg cgccgcacat gagccctccc 241 cgcctggggg cctggacgca cgccaggcgc tgccccgcgc ccacccagcc ggttcctttc 301 atgcggggcc tggagacctg cagaaatggg cccagtccca agatgggttt gaacataaag 361 agtttttttc atcccaggtg gggagaaaat ctcaaagtgc tttctacccg gaggatgacg 421 actacttttt tgctgctggt cagccagggt ggcacagcca cactcagggg acattgggat 481 tcccttcccc cggggagcca ggcccacggg agggggcttt tccggctgca caggtccaga 541 ggaggcgggt gaagaagagg caccggaggc agagaaggag ccacgtgttg gaggagggcg 601 acgacggcga caggctgtac tcctccatgt ccagggcctt cctgtaccgg ctctggaagg 661 ggaacgtctc ttccaaaatg ctgaacccgc gcctgcagaa ggcgatgaag gattacctga 721 ccgccaacaa gcacggggtg cgcttccgcg ggaagcggga ggccgggctg agcagggcac 781 agctgctgtg ccagctgcgg agccgcgcgc gcgtgcggac gctggacggc accgaggcgc 841 ccttttctgc gctgggctgg cggcgcctgg tgcccgccgt gcccctgagc cagctgcacc 901 cccgcggcct gcgcagctgc gctgtcgtca tgtctgcagg cgcaatcctc aactcttcct 961 tgggcgagga aatagattct catgatgcgg ttttgagatt taactctgct cctacacgtg 1021 gttatgagaa agatgttggg aataaaacca ccatacgcat cattaattcG CAGATTCTGA 1081 CCAACCCCAG CCATCACTTC ATTGACAGTT CACTGTATAA AGACGTCATT TTGGTGGCCT 1141 GGGACCCTGC CCCATATTCC GCAAATCTTA ACCTGTGGTA CAAAAAACCG GATTACAACC 1201 TGTTCACTCC ATATATTCAG CATCGTCAGA GAAACCCAAA TCAGCCATTT TACATTCTTC 1261 ATCCTAAATT TATATGGCAG CTCTGGGATA TTATCCAGGA GAACACTAAA GAGAAGATTC 1321 AACCAAACCC ACCATCTTCT GGTTTCATTG GCTCATTTGT AAAAATTGGC CATATCAGAG 1381 CTTGCAGTGA GCCGAGATCA CGCGACTGCA CTCCAGCCTG GACGACAGAG TGCCCAACTT 1441 TCTTGTACAA AGTGGTTGAT ATCGGTAAGC CTATCCCTAA CCCTCTCCTC GGTCTCGATT 1501 CTACGTAGTA ATGAACTAGT CCGTAACTTG AAAGTATTTC GATTTCTTGG CTTTATATAT 1561 CTTGTGGAAA GGACGATTAG CCAACGAATT TCATCAAGCA ACGCGTTAAG TCgacaatca 1621 acctctggat tacaaaattt gtgaaagatt