Transcript: Human NM_001278508.3

Homo sapiens zinc finger protein 180 (ZNF180), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
ZNF180 (7733)
Length:
4245
CDS:
283..2286

Additional Resources:

NCBI RefSeq record:
NM_001278508.3
NBCI Gene record:
ZNF180 (7733)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001278508.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000424467 TATGGATTTAGTGACCGTATT pLKO_005 1024 CDS 100% 10.800 15.120 N ZNF180 n/a
2 TRCN0000012999 GCTCGACTTATTGTGCATCAA pLKO.1 2143 CDS 100% 4.950 6.930 N ZNF180 n/a
3 TRCN0000013000 CCTATGGATTTAGTGACCGTA pLKO.1 1022 CDS 100% 2.640 3.696 N ZNF180 n/a
4 TRCN0000013001 CCGCAGTTCTCACCTTGTTAT pLKO.1 1884 CDS 100% 13.200 9.240 N ZNF180 n/a
5 TRCN0000436318 CCTCAGAGCATTCACCTTATT pLKO_005 970 CDS 100% 13.200 9.240 N ZNF180 n/a
6 TRCN0000431070 TGTCCTTGTTGTGCATCAAAG pLKO_005 1473 CDS 100% 10.800 7.560 N ZNF180 n/a
7 TRCN0000013002 CCCAGTTATACCCATAAGAAA pLKO.1 831 CDS 100% 5.625 3.938 N ZNF180 n/a
8 TRCN0000012998 CCTGGCAATTCCATATACAAT pLKO.1 2477 3UTR 100% 5.625 3.938 N ZNF180 n/a
9 TRCN0000218901 GCCCTATGAATGTAATCAATG pLKO_005 1596 CDS 100% 10.800 6.480 N ENSMUSG00000069586 n/a
10 TRCN0000148017 GAGAAACCTTACAGGTGTAAT pLKO.1 1423 CDS 100% 13.200 6.600 Y ZNF813 n/a
11 TRCN0000017939 CCTTACTCAACATCAGAGAAT pLKO.1 2064 CDS 100% 4.950 2.475 Y ZNF519 n/a
12 TRCN0000021816 CTGGAGAGAAACCTTACAGAT pLKO.1 1418 CDS 100% 4.950 2.475 Y ZNF253 n/a
13 TRCN0000155654 CTGGAGAGAAACCTTACAGAT pLKO.1 1418 CDS 100% 4.950 2.475 Y ZNF320 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001278508.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11237 pDONR223 100% 95.5% 94.3% None (many diffs) n/a
2 ccsbBroad304_11237 pLX_304 0% 95.5% 94.3% V5 (many diffs) n/a
Download CSV