Transcript: Human XM_017028675.2

PREDICTED: Homo sapiens glycine C-acetyltransferase (GCAT), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GCAT (23464)
Length:
1725
CDS:
23..1546

Additional Resources:

NCBI RefSeq record:
XM_017028675.2
NBCI Gene record:
GCAT (23464)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017028675.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000034583 CAGAGCATCCACAAGAATCTA pLKO.1 425 CDS 100% 5.625 7.875 N GCAT n/a
2 TRCN0000034580 CCAGAGGTTCCGTAGTAAGAT pLKO.1 1267 CDS 100% 5.625 7.875 N GCAT n/a
3 TRCN0000415943 TGCATAGCGAGGAAGACATTG pLKO_005 1470 CDS 100% 10.800 8.640 N GCAT n/a
4 TRCN0000444354 TGCTGCCTCGCCTCTAGATAT pLKO_005 938 CDS 100% 13.200 9.240 N GCAT n/a
5 TRCN0000034581 CATGCTGAAGAGAGGCATCTT pLKO.1 1381 CDS 100% 4.950 3.465 N GCAT n/a
6 TRCN0000034579 CCTTAACTTCTGTGCCAACAA pLKO.1 301 CDS 100% 4.950 3.465 N GCAT n/a
7 TRCN0000438133 GCTGAACCATGCCTCCATCAT pLKO_005 754 CDS 100% 4.950 3.465 N GCAT n/a
8 TRCN0000034582 GCTTTATCTGTGGAACCCAGA pLKO.1 408 CDS 100% 2.160 1.512 N GCAT n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017028675.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07887 pDONR223 100% 82.5% 82.2% None (many diffs) n/a
2 ccsbBroad304_07887 pLX_304 0% 82.5% 82.2% V5 (many diffs) n/a
3 TRCN0000479151 GGTATGAACATTTCTAGCAGCTAA pLX_317 25.3% 82.5% 82.2% V5 (many diffs) n/a
Download CSV