Transcript: Human NM_017666.5

Homo sapiens zinc finger protein 280C (ZNF280C), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
ZNF280C (55609)
Length:
4638
CDS:
155..2368

Additional Resources:

NCBI RefSeq record:
NM_017666.5
NBCI Gene record:
ZNF280C (55609)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_017666.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000420167 CACAAGTTGGATCGGATAATT pLKO_005 552 CDS 100% 15.000 21.000 N ZNF280C n/a
2 TRCN0000152664 GCGCAGCATCGTACATTTATA pLKO.1 1622 CDS 100% 15.000 21.000 N ZNF280C n/a
3 TRCN0000418329 AGTTGCTCGAAAGTTCTTAAA pLKO_005 1112 CDS 100% 13.200 18.480 N ZNF280C n/a
4 TRCN0000157841 CGGCTTAGATCGTATGGCTAA pLKO.1 2245 CDS 100% 4.050 5.670 N ZNF280C n/a
5 TRCN0000152337 CGCCTAGATTTCATCTTGTAT pLKO.1 468 CDS 100% 5.625 4.500 N ZNF280C n/a
6 TRCN0000419302 TGACTTGCCTTCAGAATATTA pLKO_005 2634 3UTR 100% 15.000 10.500 N ZNF280C n/a
7 TRCN0000412933 ACTGTTGAGAATGCGTCTAAA pLKO_005 512 CDS 100% 13.200 9.240 N ZNF280C n/a
8 TRCN0000414381 AGCACTGTTACCGGCAATATC pLKO_005 1221 CDS 100% 13.200 9.240 N ZNF280C n/a
9 TRCN0000428956 CAGTTTAGATCATCAACATTT pLKO_005 1409 CDS 100% 13.200 9.240 N ZNF280C n/a
10 TRCN0000150895 GCACTTGTTTCTTGCTCATAT pLKO.1 4463 3UTR 100% 13.200 9.240 N ZNF280C n/a
11 TRCN0000429647 TTATGACACTAGCTCTCATTA pLKO_005 2477 3UTR 100% 13.200 9.240 N ZNF280C n/a
12 TRCN0000152428 CTCCCAAGTTATGCTGTCAAA pLKO.1 796 CDS 100% 4.950 3.465 N ZNF280C n/a
13 TRCN0000153220 GAGCCTTGCTTTGAAGAACAT pLKO.1 1969 CDS 100% 4.950 3.465 N ZNF280C n/a
14 TRCN0000158162 CCTCAGATAAATCCCTCCACT pLKO.1 740 CDS 100% 2.640 1.584 N ZNF280C n/a
15 TRCN0000165534 GAGACAGGGTTTCACCATGTT pLKO.1 3857 3UTR 100% 4.950 2.475 Y n/a
16 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 3928 3UTR 100% 5.625 2.813 Y KLHL30 n/a
17 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 3928 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_017666.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08550 pDONR223 100% 99.9% 100% None 1851A>C n/a
2 ccsbBroad304_08550 pLX_304 0% 99.9% 100% V5 1851A>C n/a
3 TRCN0000480243 TAGAAAGACCCTTCCTTCTACCCA pLX_317 13.7% 99.9% 100% V5 1851A>C n/a
Download CSV