Transcript: Human XM_011517910.3

PREDICTED: Homo sapiens transmembrane protein 8B (TMEM8B), transcript variant X12, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TMEM8B (51754)
Length:
4503
CDS:
613..2139

Additional Resources:

NCBI RefSeq record:
XM_011517910.3
NBCI Gene record:
TMEM8B (51754)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011517910.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000156353 CATTCGGAGTCGATATGTGCT pLKO.1 1449 CDS 100% 2.640 3.696 N TMEM8B n/a
2 TRCN0000269126 TGATTTCCTGGGCTCCTTAAT pLKO_005 1581 CDS 100% 13.200 9.240 N Tmem8b n/a
3 TRCN0000269125 GGGACAACTACTTCTACATTC pLKO_005 1894 CDS 100% 10.800 7.560 N Tmem8b n/a
4 TRCN0000446292 GATGCGCTCACCTATGGATTC pLKO_005 1363 CDS 100% 6.000 4.200 N TMEM8B n/a
5 TRCN0000154310 CTGTCCACTTCTACATCTTCT pLKO.1 761 CDS 100% 4.950 3.465 N TMEM8B n/a
6 TRCN0000157767 CATCTTCTTTGGCCCAAGTGT pLKO.1 774 CDS 100% 3.000 2.100 N TMEM8B n/a
7 TRCN0000141099 CATGTTCTTCTCCACGTTCTA pLKO.1 1494 CDS 100% 4.950 2.475 Y PGAP6 n/a
8 TRCN0000139453 CACCATGTTCTTCTCCACGTT pLKO.1 1491 CDS 100% 2.640 1.320 Y PGAP6 n/a
9 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 3916 3UTR 100% 5.625 2.813 Y KLHL30 n/a
10 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 3916 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011517910.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08344 pDONR223 100% 62.7% 57% None (many diffs) n/a
2 ccsbBroad304_08344 pLX_304 0% 62.7% 57% V5 (many diffs) n/a
3 TRCN0000475160 TTTCTATAGAAACAAGTAGGGTAT pLX_317 20.7% 62.7% 57% V5 (many diffs) n/a
Download CSV