Transcript: Human XM_017015275.2

PREDICTED: Homo sapiens multivesicular body subunit 12B (MVB12B), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MVB12B (89853)
Length:
1049
CDS:
23..1036

Additional Resources:

NCBI RefSeq record:
XM_017015275.2
NBCI Gene record:
MVB12B (89853)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017015275.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000197386 CCTGTGTTTCACAAGATCATT pLKO.1 301 CDS 100% 5.625 3.938 N Mvb12b n/a
2 TRCN0000128915 GAAGCTGCGATTTGTGACATT pLKO.1 491 CDS 100% 4.950 3.465 N MVB12B n/a
3 TRCN0000128914 GAAGTCAAAGACCTCTCAGAA pLKO.1 122 CDS 100% 4.950 3.465 N MVB12B n/a
4 TRCN0000130893 GAATGGGCAGAGTACCAAGAA pLKO.1 591 CDS 100% 4.950 3.465 N MVB12B n/a
5 TRCN0000128336 GATACCTGTGTTTCACAAGAT pLKO.1 297 CDS 100% 4.950 3.465 N MVB12B n/a
6 TRCN0000129961 GATTTGTGACATTCGGATCAT pLKO.1 499 CDS 100% 4.950 3.465 N MVB12B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017015275.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09277 pDONR223 100% 65.4% 65.5% None 135G>A;664_1011del n/a
Download CSV