Transcript: Human NM_001271429.2

Homo sapiens ER membrane protein complex subunit 1 (EMC1), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
EMC1 (23065)
Length:
6574
CDS:
16..2931

Additional Resources:

NCBI RefSeq record:
NM_001271429.2
NBCI Gene record:
EMC1 (23065)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001271429.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000293860 ATGACTATGACTACGTGTTAA pLKO_005 2822 CDS 100% 13.200 18.480 N EMC1 n/a
2 TRCN0000293804 TGAATCGGGCCTGGCGATAAA pLKO_005 2912 CDS 100% 13.200 18.480 N EMC1 n/a
3 TRCN0000293859 TCCACCTTATAGGTACATTTG pLKO_005 3389 3UTR 100% 10.800 15.120 N EMC1 n/a
4 TRCN0000072442 CCATTATGGAACGCTGAGTTT pLKO.1 864 CDS 100% 4.950 6.930 N EMC1 n/a
5 TRCN0000201403 GCGATTCATCAACTATAACCA pLKO.1 2670 CDS 100% 3.000 4.200 N Emc1 n/a
6 TRCN0000298578 CAATCAGACCTACACCATTAA pLKO_005 1056 CDS 100% 13.200 10.560 N EMC1 n/a
7 TRCN0000072439 CCAGAGAACTACTGCTCATTT pLKO.1 1671 CDS 100% 13.200 10.560 N EMC1 n/a
8 TRCN0000072440 GCAGAGCGATTCATCAACTAT pLKO.1 2665 CDS 100% 5.625 3.938 N EMC1 n/a
9 TRCN0000298203 GCAGAGCGATTCATCAACTAT pLKO_005 2665 CDS 100% 5.625 3.938 N EMC1 n/a
10 TRCN0000072441 CGCAGAGCGATTCATCAACTA pLKO.1 2664 CDS 100% 4.950 3.465 N EMC1 n/a
11 TRCN0000072438 GCGTCTTGTTTGTTGCCCATT pLKO.1 3620 3UTR 100% 4.050 2.835 N EMC1 n/a
12 TRCN0000190419 CCAGTCATGGATCAAGACTAT pLKO.1 1837 CDS 100% 4.950 3.465 N Emc1 n/a
13 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 4926 3UTR 100% 5.625 2.813 Y KLHL30 n/a
14 TRCN0000014673 GCAGATCATTTGAGGTCAGAA pLKO.1 6301 3UTR 100% 4.950 2.475 Y ZNF14 n/a
15 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 4926 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001271429.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02717 pDONR223 100% 97.7% 97.6% None 220_221ins66 n/a
2 ccsbBroad304_02717 pLX_304 0% 97.7% 97.6% V5 220_221ins66 n/a
3 TRCN0000478824 GAGCCTGCCCGTACACACACTCTA pLX_317 11.8% 97.7% 97.6% V5 220_221ins66 n/a
Download CSV