Transcript: Human NM_001323567.2

Homo sapiens cysteine dioxygenase type 1 (CDO1), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
CDO1 (1036)
Length:
1209
CDS:
123..509

Additional Resources:

NCBI RefSeq record:
NM_001323567.2
NBCI Gene record:
CDO1 (1036)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001323567.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000056589 GCAGCAGTATTCATGATCATA pLKO.1 151 CDS 100% 5.625 4.500 N CDO1 n/a
2 TRCN0000306765 GCAGCAGTATTCATGATCATA pLKO_005 151 CDS 100% 5.625 4.500 N CDO1 n/a
3 TRCN0000056588 GCCTACATCAATGATTCCATT pLKO.1 297 CDS 100% 4.950 3.465 N CDO1 n/a
4 TRCN0000289558 GCCTACATCAATGATTCCATT pLKO_005 297 CDS 100% 4.950 3.465 N CDO1 n/a
5 TRCN0000056590 CGAGTAGAGAACATCAGCCAT pLKO.1 327 CDS 100% 2.640 1.848 N CDO1 n/a
6 TRCN0000056591 GCCATGCCTTTGATCAAAGAA pLKO.1 397 CDS 100% 5.625 3.375 N CDO1 n/a
7 TRCN0000289500 GCCATGCCTTTGATCAAAGAA pLKO_005 397 CDS 100% 5.625 3.375 N CDO1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001323567.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05981 pDONR223 100% 63.8% 63.5% None 0_1ins216;193A>G n/a
2 ccsbBroad304_05981 pLX_304 0% 63.8% 63.5% V5 0_1ins216;193A>G n/a
3 TRCN0000466964 TACCGGGCAGGACGAATCGCAGGC pLX_317 79.6% 63.8% 63.5% V5 0_1ins216;193A>G n/a
Download CSV