Transcript: Human NM_152556.3

Homo sapiens base methyltransferase of 25S rRNA 2 homolog (BMT2), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
BMT2 (154743)
Length:
3940
CDS:
126..1343

Additional Resources:

NCBI RefSeq record:
NM_152556.3
NBCI Gene record:
BMT2 (154743)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_152556.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000128337 GTCGTATTGAATGGTGTTGTA pLKO.1 406 CDS 100% 4.950 6.930 N BMT2 n/a
2 TRCN0000128514 CATTTAACCAACCTCAGCTTT pLKO.1 555 CDS 100% 4.950 3.465 N BMT2 n/a
3 TRCN0000130545 GAACACTGTGAGGATGAAGAA pLKO.1 312 CDS 100% 4.950 3.465 N BMT2 n/a
4 TRCN0000128425 GCACTTCTTTACTCTGGTAAA pLKO.1 2764 3UTR 100% 1.080 0.756 N BMT2 n/a
5 TRCN0000130273 CTGAACTTACAGCTTCAGCAA pLKO.1 735 CDS 100% 0.264 0.185 N BMT2 n/a
6 TRCN0000128369 GCCTTAAATATGCATGAGTCT pLKO.1 519 CDS 100% 2.640 1.584 N BMT2 n/a
7 TRCN0000217444 GATGTTGGCAGCTGCTTTAAT pLKO.1 633 CDS 100% 15.000 12.000 N Bmt2 n/a
8 TRCN0000216979 CCATTGCCAAAGTAGTATTTC pLKO.1 2015 3UTR 100% 13.200 7.920 N Bmt2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_152556.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05082 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_05082 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000470064 GTCAAGTCTTCAATCTTACTTGGC pLX_317 32.3% 100% 100% V5 n/a
Download CSV