Transcript: Mouse XM_006500022.3

PREDICTED: Mus musculus catenin, beta like 1 (Ctnnbl1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Ctnnbl1 (66642)
Length:
1805
CDS:
163..1182

Additional Resources:

NCBI RefSeq record:
XM_006500022.3
NBCI Gene record:
Ctnnbl1 (66642)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006500022.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000123611 CCCTAGCTATTGTGGAGAATA pLKO.1 143 5UTR 100% 13.200 9.240 N Ctnnbl1 n/a
2 TRCN0000332025 CCCTAGCTATTGTGGAGAATA pLKO_005 143 5UTR 100% 13.200 9.240 N Ctnnbl1 n/a
3 TRCN0000123609 CCTGTGCTTCTGTCTTCAAAT pLKO.1 1517 3UTR 100% 13.200 9.240 N Ctnnbl1 n/a
4 TRCN0000123612 ACAGCACATCTGTTACATCAT pLKO.1 969 CDS 100% 4.950 3.465 N Ctnnbl1 n/a
5 TRCN0000332093 ACAGCACATCTGTTACATCAT pLKO_005 969 CDS 100% 4.950 3.465 N Ctnnbl1 n/a
6 TRCN0000123613 CAGGCACATCATCAAGGAGTA pLKO.1 1077 CDS 100% 4.050 2.835 N Ctnnbl1 n/a
7 TRCN0000332092 CAGGCACATCATCAAGGAGTA pLKO_005 1077 CDS 100% 4.050 2.835 N Ctnnbl1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006500022.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12299 pDONR223 100% 82.5% 89% None (many diffs) n/a
Download CSV