Transcript: Mouse NM_023154.4

Mus musculus ethylmalonic encephalopathy 1 (Ethe1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-02-27
Taxon:
Mus musculus (mouse)
Gene:
Ethe1 (66071)
Length:
1484
CDS:
570..1334

Additional Resources:

NCBI RefSeq record:
NM_023154.4
NBCI Gene record:
Ethe1 (66071)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_023154.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000352523 ATCGGGATGCTCAGTTGATTA pLKO_005 745 CDS 100% 13.200 18.480 N Ethe1 n/a
2 TRCN0000120126 CAAGAGCTGCACCTATACCTA pLKO.1 662 CDS 100% 3.000 4.200 N Ethe1 n/a
3 TRCN0000120125 TCCAGGCAACTGTCTAATCTA pLKO.1 1124 CDS 100% 5.625 3.938 N Ethe1 n/a
4 TRCN0000340492 TCCAGGCAACTGTCTAATCTA pLKO_005 1124 CDS 100% 5.625 3.938 N Ethe1 n/a
5 TRCN0000120124 CAAGCTGTTGTACGCTGTGAA pLKO.1 779 CDS 100% 4.950 3.465 N Ethe1 n/a
6 TRCN0000120123 CAGCAGATAGACATTGCTGTT pLKO.1 1272 CDS 100% 0.405 0.284 N Ethe1 n/a
7 TRCN0000340569 CAGCAGATAGACATTGCTGTT pLKO_005 1272 CDS 100% 0.405 0.284 N Ethe1 n/a
8 TRCN0000120122 CCAGCTGCTCACATCCGTTAT pLKO.1 1345 3UTR 100% 10.800 6.480 N Ethe1 n/a
9 TRCN0000340493 CCAGCTGCTCACATCCGTTAT pLKO_005 1345 3UTR 100% 10.800 6.480 N Ethe1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_023154.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02774 pDONR223 100% 84.4% 90.1% None (many diffs) n/a
2 ccsbBroad304_02774 pLX_304 0% 84.4% 90.1% V5 (many diffs) n/a
3 TRCN0000471100 ATTGCTCTTCACTATCCAATAACT pLX_317 57.8% 84.4% 90.1% V5 (many diffs) n/a
Download CSV