Transcript: Mouse XM_017320094.2

PREDICTED: Mus musculus kelch-like 32 (Klhl32), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Klhl32 (212390)
Length:
1397
CDS:
476..1222

Additional Resources:

NCBI RefSeq record:
XM_017320094.2
NBCI Gene record:
Klhl32 (212390)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017320094.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

No results found.

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017320094.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_16077 pDONR223 0% 51.2% 53.4% None (many diffs) n/a
2 ccsbBroad304_16077 pLX_304 0% 51.2% 53.4% V5 (many diffs) n/a
3 TRCN0000475586 AGCCTCTCCTTGCTATCGAGCAAG pLX_317 70.9% 51.2% 53.4% V5 (many diffs) n/a
4 ccsbBroadEn_13037 pDONR223 100% 46.5% 44.1% None (many diffs) n/a
5 ccsbBroad304_13037 pLX_304 0% 46.5% 44.1% V5 (many diffs) n/a
6 TRCN0000471330 GTTTAGTAACCGAACCCGCTACAT pLX_317 28.1% 46.5% 44.1% V5 (many diffs) n/a
Download CSV