Transcript: Mouse XM_017320451.2

PREDICTED: Mus musculus transmembrane and coiled-coil domains 4 (Tmco4), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Tmco4 (77056)
Length:
4852
CDS:
1399..2664

Additional Resources:

NCBI RefSeq record:
XM_017320451.2
NBCI Gene record:
Tmco4 (77056)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017320451.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000126958 CGGCAGATACCGCACATTTAA pLKO.1 2256 CDS 100% 15.000 12.000 N Tmco4 n/a
2 TRCN0000416859 CACTCAAGAATGGACACTATG pLKO_005 1760 CDS 100% 10.800 7.560 N Tmco4 n/a
3 TRCN0000126955 CCGACATCTTTGCTCAGACTT pLKO.1 1676 CDS 100% 4.950 3.465 N Tmco4 n/a
4 TRCN0000128110 CCTGACAGGATACAAGATGAA pLKO.1 2139 CDS 100% 4.950 3.465 N TMCO4 n/a
5 TRCN0000126957 GCTGTTATGACTTCACTGTTT pLKO.1 2101 CDS 100% 4.950 3.465 N Tmco4 n/a
6 TRCN0000126956 GCTACATATCACCATTGCCAT pLKO.1 2217 CDS 100% 2.640 1.848 N Tmco4 n/a
7 TRCN0000166364 CACACACACACACACACACAA pLKO.1 3690 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017320451.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09906 pDONR223 100% 55.4% 57.5% None (many diffs) n/a
2 ccsbBroad304_09906 pLX_304 0% 55.4% 57.5% V5 (many diffs) n/a
Download CSV