Transcript: Mouse XM_003689208.3

PREDICTED: Mus musculus ferritin light chain 1 (LOC100862446), mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
LOC100862446 (100862446)
Length:
971
CDS:
224..775

Additional Resources:

NCBI RefSeq record:
XM_003689208.3
NBCI Gene record:
LOC100862446 (100862446)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_003689208.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000444132 TCAAGTCTTGGACCAAGTAAA pLKO_005 896 3UTR 100% 13.200 6.600 Y Ftl2-ps n/a
2 TRCN0000250445 ATCTGGATAAGGAGGTGAAAC pLKO_005 624 CDS 100% 10.800 5.400 Y Ftl1 n/a
3 TRCN0000250444 CCATGGAGAAGAACCTGAATC pLKO_005 528 CDS 100% 10.800 5.400 Y Ftl1 n/a
4 TRCN0000250443 CTCTGGGCGAGTATCTCTTTG pLKO_005 729 CDS 100% 10.800 5.400 Y Ftl1 n/a
5 TRCN0000265299 GAAGCCATCTCAAGATGAATG pLKO_005 472 CDS 100% 10.800 5.400 Y Ftl1 n/a
6 TRCN0000439474 AGGTGAAACTCATCAAGAAGA pLKO_005 636 CDS 100% 4.950 2.475 Y Ftl2-ps n/a
7 TRCN0000196221 GATGTGCAGAAGCCATCTCAA pLKO.1 464 CDS 100% 4.950 2.475 Y Ftl2-ps n/a
8 TRCN0000451671 CCTCACTCTCAAGCACGACTA pLKO_005 754 CDS 100% 4.050 2.025 Y Ftl2-ps n/a
9 TRCN0000444414 GAACCTGAATCAGGCCCTCTT pLKO_005 538 CDS 100% 4.050 2.025 Y Ftl2-ps n/a
10 TRCN0000453299 CACTCTTCCAGGATGTGCAGA pLKO_005 453 CDS 100% 2.640 1.320 Y Ftl2-ps n/a
11 TRCN0000449628 TATCTCTTTGAGCGCCTCACT pLKO_005 740 CDS 100% 2.640 1.320 Y Ftl2-ps n/a
12 TRCN0000258043 TACCTCTCTCTGGGCTTCTTT pLKO_005 314 CDS 100% 0.000 0.000 Y Ftl1 n/a
13 TRCN0000450217 TGACTTCCTGGAAAGCCACTT pLKO_005 604 CDS 100% 4.050 2.025 Y Ftl2-ps n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_003689208.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00594 pDONR223 100% 81.6% 78.1% None (many diffs) n/a
2 ccsbBroad304_00594 pLX_304 0% 81.6% 78.1% V5 (many diffs) n/a
3 TRCN0000471307 CGGGGGCATCATTGAAGAAAGTCA pLX_317 80% 81.6% 78.1% V5 (many diffs) n/a
4 TRCN0000470657 CTTACCGTACTACTGTAATCAAAC pLX_317 84.9% 81.6% 78.1% V5 (many diffs) n/a
5 ccsbBroadEn_06226 pDONR223 100% 81.2% 77.5% None (many diffs) n/a
6 ccsbBroad304_06226 pLX_304 0% 81.2% 77.5% V5 (many diffs) n/a
Download CSV