Transcript: Mouse XM_003945446.4

PREDICTED: Mus musculus predicted gene 10698 (Gm10698), mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Gm10698 (100862175)
Length:
1248
CDS:
82..687

Additional Resources:

NCBI RefSeq record:
XM_003945446.4
NBCI Gene record:
Gm10698 (100862175)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_003945446.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000113139 GTCCACTATGACTCCAAAGAT pLKO.1 375 CDS 100% 5.625 2.813 Y Tmed2 n/a
2 TRCN0000113138 GAGCCATCAATGACAACACAA pLKO.1 557 CDS 100% 4.950 2.475 Y Tmed2 n/a
3 TRCN0000113137 GCTCATCAGAACAAGCTAGAA pLKO.1 454 CDS 100% 4.950 2.475 Y Tmed2 n/a
4 TRCN0000113136 TGGAGATCACAGGACCAGATA pLKO.1 257 CDS 100% 4.950 2.475 Y Tmed2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_003945446.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07715 pDONR223 100% 91.5% 99% None (many diffs) n/a
2 ccsbBroad304_07715 pLX_304 0% 91.5% 99% V5 (many diffs) n/a
3 TRCN0000468252 CATCGCAGTGGCCGCTCCATTTTC pLX_317 59.2% 91.5% 99% V5 (many diffs) n/a
Download CSV