Transcript: Human XM_005244942.3

PREDICTED: Homo sapiens E74 like ETS transcription factor 3 (ELF3), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ELF3 (1999)
Length:
916
CDS:
133..780

Additional Resources:

NCBI RefSeq record:
XM_005244942.3
NBCI Gene record:
ELF3 (1999)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005244942.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000013867 CAACTACTTCAGTGCGATGTA pLKO.1 168 CDS 100% 4.950 3.465 N ELF3 n/a
2 TRCN0000054415 CCAAGTGGAGAAGAACAAGTA pLKO.1 366 CDS 100% 4.950 3.465 N Elf3 n/a
3 TRCN0000013866 GCTCTTCTGATGAGCTCAGTT pLKO.1 524 CDS 100% 4.950 2.970 N ELF3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005244942.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13852 pDONR223 100% 57.1% 54.6% None (many diffs) n/a
2 ccsbBroad304_13852 pLX_304 0% 57.1% 54.6% V5 (not translated due to frame shift) (many diffs) n/a
3 TRCN0000475086 TGACCTAACGTTTGTTCGTAATGG pLX_317 15.5% 57.1% 54.6% V5 (not translated due to frame shift) (many diffs) n/a
Download CSV