Transcript: Human XM_005244946.1

PREDICTED: Homo sapiens CREB regulated transcription coactivator 2 (CRTC2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CRTC2 (200186)
Length:
2671
CDS:
141..2237

Additional Resources:

NCBI RefSeq record:
XM_005244946.1
NBCI Gene record:
CRTC2 (200186)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005244946.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000229830 GCTTCCAATCCGCGCAAATTT pLKO_005 186 CDS 100% 15.000 21.000 N CRTC2 n/a
2 TRCN0000229833 GGGTATTCTGGATGGTGAAAT pLKO_005 746 CDS 100% 13.200 18.480 N CRTC2 n/a
3 TRCN0000229832 CCTATAGTCCTGCCTACTTAT pLKO_005 526 CDS 100% 13.200 9.240 N CRTC2 n/a
4 TRCN0000229831 CAGCGAGATCCTCGAAGAATG pLKO_005 462 CDS 100% 10.800 7.560 N CRTC2 n/a
5 TRCN0000218012 CCTAAAGCACTTGTAACTTTG pLKO_005 2450 3UTR 100% 10.800 7.560 N CRTC2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005244946.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09804 pDONR223 100% 99.2% 99.2% None 635_649del;1206C>T n/a
2 ccsbBroad304_09804 pLX_304 0% 99.2% 99.2% V5 635_649del;1206C>T n/a
3 TRCN0000478076 ATCGTATTCAACCATGAACAGTCC pLX_317 15.3% 99.2% 99.2% V5 635_649del;1206C>T n/a
Download CSV