Construct: ORF TRCN0000478076
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF000941.1_s317c1
- Derived from:
- ccsbBroadEn_09804
- DNA Barcode:
- ATCGTATTCAACCATGAACAGTCC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- CRTC2 (200186)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000478076
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 200186 | CRTC2 | CREB regulated transcriptio... | NM_181715.3 | 99.9% | 100% | 1191C>T |
2 | human | 200186 | CRTC2 | CREB regulated transcriptio... | XM_005244946.1 | 99.2% | 99.2% | 635_649del;1206C>T |
3 | human | 200186 | CRTC2 | CREB regulated transcriptio... | XM_017000576.1 | 88.5% | 71.1% | (many diffs) |
4 | human | 200186 | CRTC2 | CREB regulated transcriptio... | XM_017000575.1 | 87.9% | 70.6% | (many diffs) |
5 | human | 200186 | CRTC2 | CREB regulated transcriptio... | XM_017000578.1 | 85.3% | 71.5% | 0_1ins199;303_304ins104;888C>T |
6 | human | 200186 | CRTC2 | CREB regulated transcriptio... | XM_017000577.1 | 84.7% | 71% | (many diffs) |
7 | human | 200186 | CRTC2 | CREB regulated transcriptio... | XM_005244949.2 | 83% | 83% | 0_1ins339;296_310del;867C>T |
8 | human | 200186 | CRTC2 | CREB regulated transcriptio... | XM_017000579.1 | 69.8% | 69.5% | (many diffs) |
9 | human | 200186 | CRTC2 | CREB regulated transcriptio... | XR_001737032.2 | 62.9% | 1_140del;1134_1135ins407;1813_2249del | |
10 | human | 200186 | CRTC2 | CREB regulated transcriptio... | XR_001737031.2 | 62.5% | (many diffs) | |
11 | mouse | 74343 | Crtc2 | CREB regulated transcriptio... | NM_028881.2 | 90% | 92% | (many diffs) |
12 | mouse | 74343 | Crtc2 | CREB regulated transcriptio... | XM_006502152.1 | 87.1% | 89.1% | (many diffs) |
13 | mouse | 74343 | Crtc2 | CREB regulated transcriptio... | XM_006502153.1 | 79% | 81.7% | (many diffs) |
14 | mouse | 74343 | Crtc2 | CREB regulated transcriptio... | XR_375593.1 | 66.5% | (many diffs) | |
15 | mouse | 74343 | Crtc2 | CREB regulated transcriptio... | XM_006502154.1 | 66.1% | 67.2% | (many diffs) |
16 | mouse | 74343 | Crtc2 | CREB regulated transcriptio... | XR_001783761.1 | 64.7% | (many diffs) | |
17 | mouse | 74343 | Crtc2 | CREB regulated transcriptio... | XR_001783762.1 | 54.5% | (many diffs) | |
18 | mouse | 74343 | Crtc2 | CREB regulated transcriptio... | XR_001783763.1 | 48% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 2145
- ORF length:
- 2079
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc gacgtcgggg gcgaacgggc ctggttcggc cacggcctcg gcttccaatc 121 cgcgcaaatt tagtgagaag attgcgctgc agaagcagcg tcaggccgag gagacggcgg 181 ccttcgagga ggtgatgatg gacatcggct ccacccggtt acaggcccaa aaactgcgac 241 tggcatacac aaggagctct cattatggtg ggtctctgcc caatgttaac cagattggct 301 ctggcctggc cgagttccag agccccctcc actcaccttt ggattcatct cggagcactc 361 ggcaccatgg gctggtggaa cgggtgcagc gagatcctcg aagaatggtg tccccacttc 421 gccgatacac ccgccacatt gacagctctc cctatagtcc tgcctactta tctcctcccc 481 cagagtctag ctggcgaagg acgatggcct ggggcaattt ccctgcagag aaggggcagt 541 tgtttcgact accatctgca cttaacagga caagctctga ctctgccctt catacaagtg 601 tgatgaaccc cagtccccag gatacctacc caggccccac acctcccagc atcctgccca 661 gccgacgtgg gggtattctg gatggtgaaa tggaccccaa agtacctgct attgaggaga 721 acttgctaga tgacaagcat ttgctgaagc catgggatgc taagaagcta tcctcatcct 781 cttcccgacc tcggtcctgt gaagtccctg gaattaacat ctttccatct cctgaccagc 841 ctgccaatgt gcctgtcctc ccacctgcca tgaacacggg gggctcccta cctgacctca 901 ccaacctgca ctttccccca ccactgccca cccccctgga ccctgaagag acagcctacc 961 ctagcctgag tgggggcaac agtacctcca atttgaccca caccatgact cacctgggca 1021 tcagcagggg catgggcctg ggcccaggct atgatgcacc aggacttcat tcacctctca 1081 gccacccatc cctgcagtcc tccctaagca atcccaacct ccaggcttcc ctgagcagtc 1141 ctcagcccca gcttcagggc tcccacagcc acccctctct gcctgcctcc tccttggccc 1201 gccatgtact gcccaccacc tccctgggcc acccctcact cagtgctccg gctctttcct 1261 cctcctcttc ctcctcctcc acttcatctc ctgttttggg cgccccctct taccctgctt 1321 ctacccctgg ggcctccccc caccaccgcc gtgtgcccct cagccccctg agtttgctcg 1381 cgggcccagc cgacgccaga aggtcccaac agcagctgcc caaacagttt tcgccaacaa 1441 tgtcacccac cttgtcttcc atcactcagg gcgtccccct ggataccagt aaactgtcca 1501 ctgaccagcg gttaccccca tacccataca gctccccaag tctggttctg cctacccagc 1561 cccacacccc aaagtctcta cagcagccag ggctgccctc tcagtcttgt tcagtgcagt 1621 cctcaggtgg gcagccccca ggcaggcagt ctcattatgg gacaccgtac ccacctgggc 1681 ccagtgggca tgggcaacag tcttaccacc ggccaatgag tgacttcaac ctggggaatc 1741 tggagcagtt cagcatggag agcccatcag ccagcctggt gctggatccc cctggctttt 1801 ctgaagggcc tggattttta gggggtgagg ggCCAATGGG TGGCCCCCAG GATCCCCACA 1861 CCTTCAACCA CCAGAACTTG ACCCACTGTT CCCGCCATGG CTCAGGGCCT AACATCATCC 1921 TCACAGGGGA CTCCTCTCCA GGTTTCTCTA AGGAGATTGC AGCAGCCCTG GCCGGAGTGC 1981 CTGGCTTTGA GGTGTCAGCA GCTGGATTGG AGCTAGGGCT TGGGCTAGAA GATGAGCTGC 2041 GCATGGAGCC ACTGGGCCTG GAAGGGCTAA ACATGCTGAG TGACCCCTGT GCCCTGCTGC 2101 CTGATCCTGC TGTGGAGGAG TCATTCCGCA GTGACCGGCT CCAATGCCCA ACTTTCTTGT 2161 ACAAAGTGGT TGATATCGGT AAGCCTATCC CTAACCCTCT CCTCGGTCTC GATTCTACGT 2221 AGTAATGAAC TAGTCCGTAA CTTGAAAGTA TTTCGATTTC TTGGCTTTAT ATATCTTGTG 2281 GAAAGGACGA ATCGTATTCA ACCATGAACA GTCCACGCGT TAAGTCgaca atcaacctct 2341 ggattacaaa atttgtgaaa gatt