Transcript: Human XM_005245017.2

PREDICTED: Homo sapiens proline rich coiled-coil 2C (PRRC2C), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PRRC2C (23215)
Length:
10658
CDS:
298..8994

Additional Resources:

NCBI RefSeq record:
XM_005245017.2
NBCI Gene record:
PRRC2C (23215)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005245017.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000142283 GCCTGCAGTTAAGACTGTAAA pLKO.1 3651 CDS 100% 13.200 18.480 N PRRC2C n/a
2 TRCN0000343832 GCCTGCAGTTAAGACTGTAAA pLKO_005 3651 CDS 100% 13.200 18.480 N PRRC2C n/a
3 TRCN0000141587 CCCACAAATGGCACAGTTAAT pLKO.1 4669 CDS 100% 13.200 10.560 N PRRC2C n/a
4 TRCN0000139677 CCCAGTTTACGTCCACCAAAT pLKO.1 805 CDS 100% 10.800 8.640 N PRRC2C n/a
5 TRCN0000139143 CCCGGTTTACTGTGTTGAGTT pLKO.1 10484 3UTR 100% 4.950 3.960 N PRRC2C n/a
6 TRCN0000141560 CCTGGATGAATGAGCAGATAA pLKO.1 9591 3UTR 100% 13.200 9.240 N PRRC2C n/a
7 TRCN0000140632 GCCAGCCTTTCAGAGGATTAA pLKO.1 8201 CDS 100% 13.200 9.240 N PRRC2C n/a
8 TRCN0000343834 GCCAGCCTTTCAGAGGATTAA pLKO_005 8201 CDS 100% 13.200 9.240 N PRRC2C n/a
9 TRCN0000141677 CGGCTGTATTATCTGGCTATT pLKO.1 2273 CDS 100% 10.800 7.560 N PRRC2C n/a
10 TRCN0000139644 CCAGCAGGTTACAGTACCTTT pLKO.1 8040 CDS 100% 4.950 3.465 N PRRC2C n/a
11 TRCN0000343833 CCAGCAGGTTACAGTACCTTT pLKO_005 8040 CDS 100% 4.950 3.465 N PRRC2C n/a
12 TRCN0000143461 GCTGCTTATTCTGTAGAACAT pLKO.1 2836 CDS 100% 4.950 3.465 N PRRC2C n/a
13 TRCN0000141012 CGCAAGTTTATGTGTCTCAGT pLKO.1 7427 CDS 100% 2.640 1.848 N PRRC2C n/a
14 TRCN0000140164 GCAACAATGGTCCACCCAAAT pLKO.1 4970 CDS 100% 10.800 6.480 N PRRC2C n/a
15 TRCN0000343898 GCAACAATGGTCCACCCAAAT pLKO_005 4970 CDS 100% 10.800 6.480 N PRRC2C n/a
16 TRCN0000143109 GCATCCTTGAACCATATCAAA pLKO.1 9624 3UTR 100% 5.625 3.375 N PRRC2C n/a
17 TRCN0000343899 GCATCCTTGAACCATATCAAA pLKO_005 9624 3UTR 100% 5.625 3.375 N PRRC2C n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005245017.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.