Transcript: Human XM_005247172.2

PREDICTED: Homo sapiens dishevelled segment polarity protein 3 (DVL3), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DVL3 (1857)
Length:
4498
CDS:
326..2482

Additional Resources:

NCBI RefSeq record:
XM_005247172.2
NBCI Gene record:
DVL3 (1857)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005247172.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000296465 CGTCACCTTGGCGGACTTTAA pLKO_005 406 CDS 100% 13.200 18.480 N DVL3 n/a
2 TRCN0000296516 CAAGTCTATGGACGACGATTT pLKO_005 463 CDS 100% 10.800 15.120 N DVL3 n/a
3 TRCN0000033346 CAGGTAAACGAGATCAACTTT pLKO.1 1226 CDS 100% 5.625 7.875 N DVL3 n/a
4 TRCN0000033344 GCGACCCAGCTATAAGTTCTT pLKO.1 439 CDS 100% 4.950 6.930 N DVL3 n/a
5 TRCN0000033348 CCGGCTAAATGGAACTGCGAA pLKO.1 793 CDS 100% 2.640 3.696 N DVL3 n/a
6 TRCN0000033347 CCTAATGCTTTCATCGGCTCA pLKO.1 1640 CDS 100% 2.160 3.024 N DVL3 n/a
7 TRCN0000296464 TGACATGGCTGCCATCGTAAA pLKO_005 1555 CDS 100% 10.800 7.560 N DVL3 n/a
8 TRCN0000033345 GCCAAGCTACCATGCTTCAAT pLKO.1 518 CDS 100% 5.625 3.938 N DVL3 n/a
9 TRCN0000290071 GCCAAGCTACCATGCTTCAAT pLKO_005 518 CDS 100% 5.625 3.938 N DVL3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005247172.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06132 pDONR223 100% 98.6% 98.7% None (many diffs) n/a
2 ccsbBroad304_06132 pLX_304 26.3% 98.6% 98.7% V5 (many diffs) n/a
3 TRCN0000468071 AATAGTCATTGGCTTTGCTCCGAA pLX_317 14.8% 98.6% 98.7% V5 (many diffs) n/a
Download CSV