Transcript: Human XM_005247295.3

PREDICTED: Homo sapiens ABI family member 3 binding protein (ABI3BP), transcript variant X24, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ABI3BP (25890)
Length:
6498
CDS:
89..5332

Additional Resources:

NCBI RefSeq record:
XM_005247295.3
NBCI Gene record:
ABI3BP (25890)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005247295.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000414551 TCTATCCCTTCTACACCTAAA pLKO_005 1628 CDS 100% 10.800 15.120 N ABI3BP n/a
2 TRCN0000168421 GCTTTGTCAAACTATCCCTTT pLKO.1 6056 3UTR 100% 4.050 5.670 N ABI3BP n/a
3 TRCN0000200577 CCCAACACAGTTTATGAATTT pLKO.1 665 CDS 100% 13.200 9.240 N Abi3bp n/a
4 TRCN0000166956 GAGAGAATAGAGACAGATATA pLKO.1 4376 CDS 100% 13.200 9.240 N ABI3BP n/a
5 TRCN0000424481 TTGATGCAGAGCCGAAATATC pLKO_005 366 CDS 100% 13.200 9.240 N ABI3BP n/a
6 TRCN0000420282 GCCGGAACAATTACACCTAAA pLKO_005 1700 CDS 100% 10.800 7.560 N ABI3BP n/a
7 TRCN0000168529 CCACTGAAACAATTGTGGAAA pLKO.1 636 CDS 100% 4.950 3.465 N ABI3BP n/a
8 TRCN0000168490 GCACAAAGTTACCTTCTGTTT pLKO.1 5338 3UTR 100% 4.950 3.465 N ABI3BP n/a
9 TRCN0000168708 GCTGAGAGTATTTATCAGGTT pLKO.1 5485 3UTR 100% 2.640 1.848 N ABI3BP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005247295.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07957 pDONR223 100% 61.5% 61.5% None (many diffs) n/a
2 ccsbBroad304_07957 pLX_304 0% 61.5% 61.5% V5 (many diffs) n/a
3 TRCN0000468708 CCGGTCCGCGTCGCACCTTAGAAA pLX_317 13.6% 61.5% 61.5% V5 (many diffs) n/a
Download CSV