Transcript: Human XM_005247364.3

PREDICTED: Homo sapiens golgi integral membrane protein 4 (GOLIM4), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GOLIM4 (27333)
Length:
4035
CDS:
345..2438

Additional Resources:

NCBI RefSeq record:
XM_005247364.3
NBCI Gene record:
GOLIM4 (27333)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005247364.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000144373 CAGACTCAAGTTGCAGAATAT pLKO.1 1026 CDS 100% 13.200 17.160 N GOLIM4 n/a
2 TRCN0000126036 GCAAGATTCCAATAGCAGATA pLKO.1 656 CDS 100% 4.950 3.960 N Golim4 n/a
3 TRCN0000325674 GCAAGATTCCAATAGCAGATA pLKO_005 656 CDS 100% 4.950 3.960 N Golim4 n/a
4 TRCN0000144953 GCTCAAACATAAATCTGCCTA pLKO.1 2488 3UTR 100% 2.640 2.112 N GOLIM4 n/a
5 TRCN0000423265 ACAGATCAAGATTAGAGAAAT pLKO_005 544 CDS 100% 13.200 9.240 N GOLIM4 n/a
6 TRCN0000419143 GCGCATACATTTATATGAATA pLKO_005 2578 3UTR 100% 13.200 9.240 N GOLIM4 n/a
7 TRCN0000139974 GCTGCCCTTCTGATGTCTTTA pLKO.1 2879 3UTR 100% 13.200 9.240 N GOLIM4 n/a
8 TRCN0000437694 CTCTATGCTCCCACCCATAAG pLKO_005 1254 CDS 100% 10.800 7.560 N GOLIM4 n/a
9 TRCN0000140441 GCAGAAGGAGATCCAGGTAAT pLKO.1 1893 CDS 100% 10.800 7.560 N GOLIM4 n/a
10 TRCN0000138999 CAAGAAGTGGAACGCAGAGAA pLKO.1 1311 CDS 100% 4.950 3.465 N GOLIM4 n/a
11 TRCN0000143576 GCAGTTGCTGAGAAATCACAT pLKO.1 2400 CDS 100% 4.950 3.465 N GOLIM4 n/a
12 TRCN0000144554 GAAGATATAAACCCAGCAGAT pLKO.1 1983 CDS 100% 4.050 2.835 N GOLIM4 n/a
13 TRCN0000140502 GCAGAACATCTTGAGGAGGAA pLKO.1 1404 CDS 100% 2.640 1.848 N GOLIM4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005247364.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.