Transcript: Human XM_005247666.1

PREDICTED: Homo sapiens heart development protein with EGF like domains 1 (HEG1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
HEG1 (57493)
Length:
9451
CDS:
64..4509

Additional Resources:

NCBI RefSeq record:
XM_005247666.1
NBCI Gene record:
HEG1 (57493)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005247666.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000253692 GATCTCAGAGGCGGATCTTTA pLKO_005 3857 CDS 100% 13.200 18.480 N HEG1 n/a
2 TRCN0000253693 ACCTTCGTGACAGAGTTTAAA pLKO_005 3562 CDS 100% 15.000 10.500 N HEG1 n/a
3 TRCN0000253691 AGCATGTGAAGATGGATATAG pLKO_005 4014 CDS 100% 13.200 9.240 N HEG1 n/a
4 TRCN0000253694 CATTGGGAGATAGGAGTTATT pLKO_005 1565 CDS 100% 13.200 9.240 N HEG1 n/a
5 TRCN0000253690 TTCCGTATGGAGTGGATTAAG pLKO_005 6699 3UTR 100% 13.200 9.240 N HEG1 n/a
6 TRCN0000097251 CGAGCATGTGAAGATGGATAT pLKO.1 4012 CDS 100% 10.800 7.560 N Heg1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005247666.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.