Transcript: Human XM_005247715.4

PREDICTED: Homo sapiens coiled-coil domain containing 14 (CCDC14), transcript variant X9, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CCDC14 (64770)
Length:
2325
CDS:
95..2197

Additional Resources:

NCBI RefSeq record:
XM_005247715.4
NBCI Gene record:
CCDC14 (64770)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005247715.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000134762 GCAACCATTAAGAAGTGAGAA pLKO.1 1546 CDS 100% 4.950 6.930 N CCDC14 n/a
2 TRCN0000436053 AGAATGTATTCACCCATAATA pLKO_005 692 CDS 100% 15.000 10.500 N CCDC14 n/a
3 TRCN0000426282 GACTCGACTAAGAGAATTAAC pLKO_005 1993 CDS 100% 13.200 9.240 N CCDC14 n/a
4 TRCN0000431013 TCAATTGGAGGAGTCACTAAA pLKO_005 1702 CDS 100% 13.200 9.240 N CCDC14 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005247715.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12487 pDONR223 100% 50.2% 47.1% None (many diffs) n/a
2 ccsbBroad304_12487 pLX_304 0% 50.2% 47.1% V5 (many diffs) n/a
3 TRCN0000471629 TGTATTAAACACTTCTTTCGCGGC pLX_317 17.8% 50.2% 47.1% V5 (many diffs) n/a
Download CSV