Transcript: Human XM_005247837.2

PREDICTED: Homo sapiens calcium sensing receptor (CASR), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CASR (846)
Length:
4151
CDS:
86..2839

Additional Resources:

NCBI RefSeq record:
XM_005247837.2
NBCI Gene record:
CASR (846)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005247837.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000356739 TCGGGTATTACAACGTCTATG pLKO_005 1125 CDS 100% 10.800 15.120 N CASR n/a
2 TRCN0000356800 AGGATGGCTCCATCGTGTTTA pLKO_005 1098 CDS 100% 13.200 9.240 N CASR n/a
3 TRCN0000008175 GCTGGGTGTGTTTATCAAGTT pLKO.1 1492 CDS 100% 4.950 3.465 N CASR n/a
4 TRCN0000008171 CCAAGAAAGATCCACCCTCAA pLKO.1 3828 3UTR 100% 4.050 2.835 N CASR n/a
5 TRCN0000008174 CCTTACATAGATTACACGCAT pLKO.1 821 CDS 100% 2.640 1.848 N CASR n/a
6 TRCN0000008173 CCAGATGACTTCTGGTCCAAT pLKO.1 1358 CDS 100% 0.495 0.347 N CASR n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005247837.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000487915 TAAGTGGTTAGCTTAGGCCAATGG pLX_317 9.2% 84.8% 84.6% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV