Transcript: Human XM_005247855.1

PREDICTED: Homo sapiens beta-1,4-galactosyltransferase 4 (B4GALT4), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
B4GALT4 (8702)
Length:
2319
CDS:
478..1512

Additional Resources:

NCBI RefSeq record:
XM_005247855.1
NBCI Gene record:
B4GALT4 (8702)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005247855.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000036323 GTTACGTTACAGTGGATATTT pLKO.1 1152 CDS 100% 15.000 21.000 N B4GALT4 n/a
2 TRCN0000430797 ATGGATACTTGAAGGACTTTA pLKO_005 1742 3UTR 100% 13.200 9.240 N B4GALT4 n/a
3 TRCN0000036320 CGAGAATGACTTTAACCTTTA pLKO.1 1074 CDS 100% 10.800 7.560 N B4GALT4 n/a
4 TRCN0000036319 GCCATTCAAGAGATTCCTAAA pLKO.1 586 CDS 100% 10.800 7.560 N B4GALT4 n/a
5 TRCN0000018779 GAATGGATTCTCTAACAACTA pLKO.1 1215 CDS 100% 4.950 3.465 N B4galt4 n/a
6 TRCN0000036321 CGGATGAAGCTCTTACACCAA pLKO.1 1378 CDS 100% 2.640 1.848 N B4GALT4 n/a
7 TRCN0000036322 CCTGCCTGAAGTGGGTAAATA pLKO.1 1308 CDS 100% 15.000 9.000 N B4GALT4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005247855.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07289 pDONR223 100% 99.9% 99.7% None 346C>G n/a
2 ccsbBroad304_07289 pLX_304 0% 99.9% 99.7% V5 346C>G n/a
3 TRCN0000469823 GCCGTCGTCTTACGACTTTAATTA pLX_317 41% 99.9% 99.7% V5 346C>G n/a
4 ccsbBroadEn_07288 pDONR223 100% 99.9% 99.7% None 346C>G n/a
5 ccsbBroad304_07288 pLX_304 0% 99.9% 99.7% V5 346C>G n/a
6 TRCN0000480721 ATCACAATCTAAGGAACCCACAAT pLX_317 43.1% 99.9% 99.7% V5 346C>G n/a
Download CSV