Transcript: Human XM_005247917.3

PREDICTED: Homo sapiens DAZ interacting zinc finger protein 3 (DZIP3), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DZIP3 (9666)
Length:
4549
CDS:
153..3779

Additional Resources:

NCBI RefSeq record:
XM_005247917.3
NBCI Gene record:
DZIP3 (9666)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005247917.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000434465 CTATCATCTGCTTCATATAAT pLKO_005 1331 CDS 100% 15.000 10.500 N DZIP3 n/a
2 TRCN0000413521 TACTGACATTGTTCGACAAAT pLKO_005 1364 CDS 100% 13.200 9.240 N DZIP3 n/a
3 TRCN0000034244 CGGAAATTGAAGGATGCTTAT pLKO.1 3324 CDS 100% 10.800 7.560 N DZIP3 n/a
4 TRCN0000034245 CCACCTCTCATGGAGTACAAT pLKO.1 1989 CDS 100% 5.625 3.938 N DZIP3 n/a
5 TRCN0000034248 CCTCACATTAAGAAGTTCTTA pLKO.1 360 CDS 100% 5.625 3.938 N DZIP3 n/a
6 TRCN0000034247 CGATTTGTAGTTACCTAGATT pLKO.1 901 CDS 100% 5.625 3.938 N DZIP3 n/a
7 TRCN0000034246 CCATACTTACTGTTCCTCAAA pLKO.1 3085 CDS 100% 4.950 3.465 N DZIP3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005247917.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02223 pDONR223 100% 99.9% 100% None 2907T>C n/a
2 ccsbBroad304_02223 pLX_304 0% 99.9% 100% V5 2907T>C n/a
3 TRCN0000480525 AAGGTCATTAATAATACAACTAGC pLX_317 10.1% 99.9% 100% V5 2907T>C n/a
Download CSV