Transcript: Human XM_005247979.4

PREDICTED: Homo sapiens protein phosphatase 2 regulatory subunit Bgamma (PPP2R2C), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PPP2R2C (5522)
Length:
4283
CDS:
867..1559

Additional Resources:

NCBI RefSeq record:
XM_005247979.4
NBCI Gene record:
PPP2R2C (5522)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005247979.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000006867 CCGCTCATTCTTCTCGGAAAT pLKO.1 1034 CDS 100% 10.800 15.120 N PPP2R2C n/a
2 TRCN0000352690 CCGCTCATTCTTCTCGGAAAT pLKO_005 1034 CDS 100% 10.800 15.120 N PPP2R2C n/a
3 TRCN0000006869 CTGTACGAGAACGACTGCATT pLKO.1 1209 CDS 100% 4.950 3.465 N PPP2R2C n/a
4 TRCN0000342496 CTGTACGAGAACGACTGCATT pLKO_005 1209 CDS 100% 4.950 3.465 N PPP2R2C n/a
5 TRCN0000039561 TTTCCTAGGCCAGAATTGTGT pLKO.1 1728 3UTR 100% 3.000 2.100 N PPP2R2C n/a
6 TRCN0000006865 CCTTGTAAAGAGGTTCGAGAA pLKO.1 3496 3UTR 100% 4.050 2.430 N PPP2R2C n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005247979.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11051 pDONR223 100% 53.4% 53.4% None 0_1ins600;636C>T n/a
2 ccsbBroad304_11051 pLX_304 0% 53.4% 53.4% V5 0_1ins600;636C>T n/a
3 TRCN0000480089 TCTGATCCGACTCTATAAGCTTCA pLX_317 30.3% 53.4% 53.4% V5 0_1ins600;636C>T n/a
Download CSV