Transcript: Human XM_005248017.4

PREDICTED: Homo sapiens actin binding LIM protein family member 2 (ABLIM2), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ABLIM2 (84448)
Length:
3766
CDS:
100..2088

Additional Resources:

NCBI RefSeq record:
XM_005248017.4
NBCI Gene record:
ABLIM2 (84448)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005248017.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000146821 CCTCTAAAGAACGCTTTGTAA pLKO.1 2992 3UTR 100% 5.625 7.875 N ABLIM2 n/a
2 TRCN0000149476 GAAGGCGAAGAGATGTATCTT pLKO.1 853 CDS 100% 5.625 7.875 N ABLIM2 n/a
3 TRCN0000146452 CCTAATATGCTTCCTGCCATT pLKO.1 3630 3UTR 100% 4.050 5.670 N ABLIM2 n/a
4 TRCN0000421868 ACTCACAATACAAGATCTATC pLKO_005 1880 CDS 100% 10.800 8.640 N ABLIM2 n/a
5 TRCN0000446055 GACTTGGCAGCCCTTCCTAAA pLKO_005 1048 CDS 100% 10.800 8.640 N ABLIM2 n/a
6 TRCN0000180926 GATCTCCTACTCACCCTACAT pLKO.1 1104 CDS 100% 4.950 3.960 N ABLIM2 n/a
7 TRCN0000438501 CCTACTGCGAAGCTGACTATC pLKO_005 707 CDS 100% 10.800 7.560 N ABLIM2 n/a
8 TRCN0000180854 GCAGAAGGCGAAGAGATGTAT pLKO.1 850 CDS 100% 5.625 3.938 N ABLIM2 n/a
9 TRCN0000148597 CGTGTGATTTATGCCAAGCTT pLKO.1 1003 CDS 100% 3.000 2.100 N ABLIM2 n/a
10 TRCN0000418463 GCGGCACAGAAATCAAGAATG pLKO_005 581 CDS 100% 10.800 6.480 N ABLIM2 n/a
11 TRCN0000415170 TGGAAGCTTGGACCAGGATAA pLKO_005 1716 CDS 100% 10.800 6.480 N ABLIM2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005248017.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09191 pDONR223 100% 78.5% 78.2% None (many diffs) n/a
2 ccsbBroad304_09191 pLX_304 0% 78.5% 78.2% V5 (many diffs) n/a
3 TRCN0000475266 CACGGTCTCTAGTGCACCCTAGTC pLX_317 27.8% 78.5% 78.2% V5 (many diffs) n/a
Download CSV