Transcript: Human XM_005248116.4

PREDICTED: Homo sapiens transmembrane protein 33 (TMEM33), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TMEM33 (55161)
Length:
2296
CDS:
210..953

Additional Resources:

NCBI RefSeq record:
XM_005248116.4
NBCI Gene record:
TMEM33 (55161)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005248116.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000115923 CGTCTCGAAGAAACCCATATT pLKO.1 799 CDS 100% 13.200 18.480 N TMEM33 n/a
2 TRCN0000115926 GCAATTCATGATGACCAATAA pLKO.1 254 CDS 100% 13.200 18.480 N TMEM33 n/a
3 TRCN0000175156 GCAATTCATGATGACCAATAA pLKO.1 254 CDS 100% 13.200 18.480 N Tmem33 n/a
4 TRCN0000320319 GCAATTCATGATGACCAATAA pLKO_005 254 CDS 100% 13.200 18.480 N Tmem33 n/a
5 TRCN0000115925 ACCCATATTGTCGGACCTTAT pLKO.1 811 CDS 100% 10.800 15.120 N TMEM33 n/a
6 TRCN0000423344 AGATCTGTCTTGGACAAATTA pLKO_005 636 CDS 100% 15.000 10.500 N TMEM33 n/a
7 TRCN0000413650 CACCAACAGTTCCATAGTTTA pLKO_005 937 CDS 100% 13.200 9.240 N TMEM33 n/a
8 TRCN0000420640 CTAATTGGTAACCTGAGTTTA pLKO_005 1288 3UTR 100% 13.200 9.240 N TMEM33 n/a
9 TRCN0000115924 GCTGCCACTACCTGTTGTATT pLKO.1 484 CDS 100% 13.200 9.240 N TMEM33 n/a
10 TRCN0000115922 CCATTGAGAAACATTTCTCAA pLKO.1 1679 3UTR 100% 0.495 0.347 N TMEM33 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005248116.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03539 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03539 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000469076 GCTCATCATTTATGCTCCGCAGTC pLX_317 51.7% 100% 100% V5 n/a
Download CSV